tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2012)


This file was created to facilitate the description of sequence variants in the TNFRSF10A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032107.1, covering TNFRSF10A transcript NM_003844.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5046
               gcaggtgccccgaaaagggggcggggtcaggggtgccctgaactcc       c.-61

 .         .         .         .         .         .                g.5106
 gaatgcgaagttctgtcttgtcatagccaagcacgctgcttcttggattgacctggcagg       c.-1

          .         .         .         .         .         .       g.5166
 ATGGCGCCACCACCAGCTAGAGTACATCTAGGTGCGTTCCTGGCAGTGACTCCGAATCCC       c.60
 M  A  P  P  P  A  R  V  H  L  G  A  F  L  A  V  T  P  N  P         p.20

          .         .         .         .         .         .       g.5226
 GGGAGCGCAGCGAGTGGGACAGAGGCAGCCGCGGCCACACCCAGCAAAGTGTGGGGCTCT       c.120
 G  S  A  A  S  G  T  E  A  A  A  A  T  P  S  K  V  W  G  S         p.40

          .         .         .         .         .         .       g.5286
 TCCGCGGGGAGGATTGAACCACGAGGCGGGGGCCGAGGAGCGCTCCCTACCTCCATGGGA       c.180
 S  A  G  R  I  E  P  R  G  G  G  R  G  A  L  P  T  S  M  G         p.60

          .         .         .         .         .         .       g.5346
 CAGCACGGACCCAGTGCCCGGGCCCGGGCAGGGCGCGCCCCAGGACCCAGGCCGGCGCGG       c.240
 Q  H  G  P  S  A  R  A  R  A  G  R  A  P  G  P  R  P  A  R         p.80

          .         .         .         .         .         .       g.5406
 GAAGCCAGCCCTCGGCTCCGGGTCCACAAGACCTTCAAGTTTGTCGTCGTCGGGGTCCTG       c.300
 E  A  S  P  R  L  R  V  H  K  T  F  K  F  V  V  V  G  V  L         p.100

        | 02 .         .         .         .         .         .    g.18009
 CTGCAG | GTCGTACCTAGCTCAGCTGCAACCATCAAACTTCATGATCAATCAATTGGCACA    c.360
 L  Q   | V  V  P  S  S  A  A  T  I  K  L  H  D  Q  S  I  G  T      p.120

          .         .         .         .    | 03    .         .    g.27423
 CAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAG | GATCTCATAGATCAGAA    c.420
 Q  Q  W  E  H  S  P  L  G  E  L  C  P  P  G |   S  H  R  S  E      p.140

          .         .         .         .         .         .       g.27483
 CATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAAT       c.480
 H  P  G  A  C  N  R  C  T  E  G  V  G  Y  T  N  A  S  N  N         p.160

          .         .         .        | 04.         .         .    g.28271
 TTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAG | ATGAAGAAGAGAGAAGTCCCTGC    c.540
 L  F  A  C  L  P  C  T  A  C  K  S  D |   E  E  E  R  S  P  C      p.180

          .         .         .         .         .         .       g.28331
 ACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCT       c.600
 T  T  T  R  N  T  A  C  Q  C  K  P  G  T  F  R  N  D  N  S         p.200

          .         .          | 05        .         .         .    g.29438
 GCTGAGATGTGCCGGAAGTGCAGCAGAGG | GTGCCCCAGAGGGATGGTCAAGGTCAAGGAT    c.660
 A  E  M  C  R  K  C  S  R  G  |  C  P  R  G  M  V  K  V  K  D      p.220

          .         .         .         .    | 06    .         .    g.29584
 TGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAG | GCAATGGACATAATATA    c.720
 C  T  P  W  S  D  I  E  C  V  H  K  E  S  G |   N  G  H  N  I      p.240

          .         .         .         .         .         .       g.29644
 TGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTC       c.780
 W  V  I  L  V  V  T  L  V  V  P  L  L  L  V  A  V  L  I  V         p.260

          .          | 07        .         .         .  | 08      . g.30728
 TGTTGTTGCATCGGCTCAG | GTTGTGGAGGGGACCCCAAGTGCATGGACAGG | GTGTGTTTC c.840
 C  C  C  I  G  S  G |   C  G  G  D  P  K  C  M  D  R   | V  C  F   p.280

          .         .         .         .         .         .       g.30788
 TGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAACGAGATTCTG       c.900
 W  R  L  G  L  L  R  G  P  G  A  E  D  N  A  H  N  E  I  L         p.300

          .         .         .         .         .         .       g.30848
 AGCAACGCAGACTCGCTGTCCACTTTCGTCTCTGAGCAGCAAATGGAAAGCCAGGAGCCG       c.960
 S  N  A  D  S  L  S  T  F  V  S  E  Q  Q  M  E  S  Q  E  P         p.320

          .         .         .         .         .     | 09   .    g.32969
 GCAGATTTGACAGGTGTCACTGTACAGTCCCCAGGGGAGGCACAGTGTCTGCTG | GGACCG    c.1020
 A  D  L  T  G  V  T  V  Q  S  P  G  E  A  Q  C  L  L   | G  P      p.340

          .         .         .         .         .         .       g.33029
 GCAGAAGCTGAAGGGTCTCAGAGGAGGAGGCTGCTGGTTCCAGCAAATGGTGCTGACCCC       c.1080
 A  E  A  E  G  S  Q  R  R  R  L  L  V  P  A  N  G  A  D  P         p.360

         | 10.         .         .         .         .         .    g.38207
 ACTGAGA | CTCTGATGCTGTTCTTTGACAAGTTTGCAAACATCGTGCCCTTTGACTCCTGG    c.1140
 T  E  T |   L  M  L  F  F  D  K  F  A  N  I  V  P  F  D  S  W      p.380

          .         .         .         .         .         .       g.38267
 GACCAGCTCATGAGGCAGCTGGACCTCACGAAAAATGAGATCGATGTGGTCAGAGCTGGT       c.1200
 D  Q  L  M  R  Q  L  D  L  T  K  N  E  I  D  V  V  R  A  G         p.400

          .         .         .         .         .         .       g.38327
 ACAGCAGGCCCAGGGGATGCCTTGTATGCAATGCTGATGAAATGGGTCAACAAAACTGGA       c.1260
 T  A  G  P  G  D  A  L  Y  A  M  L  M  K  W  V  N  K  T  G         p.420

          .         .         .         .         .         .       g.38387
 CGGAACGCCTCGATCCACACCCTGCTGGATGCCTTGGAGAGGATGGAAGAGAGACATGCA       c.1320
 R  N  A  S  I  H  T  L  L  D  A  L  E  R  M  E  E  R  H  A         p.440

          .         .         .         .         .         .       g.38447
 AGAGAGAAGATTCAGGACCTCTTGGTGGACTCTGGAAAGTTCATCTACTTAGAAGATGGC       c.1380
 R  E  K  I  Q  D  L  L  V  D  S  G  K  F  I  Y  L  E  D  G         p.460

          .         .                                               g.38474
 ACAGGCTCTGCCGTGTCCTTGGAGTGA                                        c.1407
 T  G  S  A  V  S  L  E  X                                          p.468

          .         .         .         .         .         .       g.38534
 aagactctttttaccagaggtttcctcttaggtgttaggagttaatacatattaggtttt       c.*60

          .         .         .         .         .         .       g.38594
 ttttttttttaacatgtatacaaagtaaattcttagccaggtgtagtggctcatgcctgt       c.*120

          .         .         .         .         .         .       g.38654
 aatcccagcactttgggaggctgaggcgggtggatcacttgaggtcagaagttcaagacc       c.*180

          .         .         .         .         .                 g.38711
 agcctgaccaacatcgtgaaatgccgtctttacaaaaaaatacaaaaattaactgga          c.*237

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor receptor superfamily, member 10a protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center