tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - downstream reference sequence


         .         .         .         .         .            . g.38714
agcctgaccaacatcgtgaaatgccgtctttacaaaaaaatacaaaaattaactgga / tgt c.*240

         .         .         .         .         .         .    g.38774
gatggtgtgtgcatatattctcggctactcgggaggctgaggcaggagaatcacttgaac    c.*300

         .         .         .         .         .         .    g.38834
ccacgaggcagtgagctgagattgcaccactgcactccagcctgggacacagagcaagac    c.*360

         .         .         .         .         .         .    g.38894
tctgtctcaagataaaataaaataaacttgaaagaattattgcccgactgaggctcacat    c.*420

         .         .         .         .         .         .    g.38954
gccaaaggaaaatctggttctcccctgagctggcctccgtgtgtttccttatcatggtgg    c.*480

         .         .         .         .         .         .    g.39014
tcaattggaggtgttaatttgaatggattaaggaacacctagaacactggtaaggcatta    c.*540

         .         .         .         .         .         .    g.39074
tttctgggacattatttctgggcatgtcttcgagggtgtttccagaggggattggcatgc    c.*600

         .         .         .         .         .         .    g.39134
gatcgggtggactgagtggaaaagacctacccttaatttgggggggcaccgtccgacaga    c.*660

         .         .         .         .         .         .    g.39194
ctggggagcaagatagaagaaaacaaaaaaaaaaggaaaagcaaatccatctgatctcct    c.*720

         .         .         .         .         .         .    g.39254
ggagctgggacactcttctgcctgtggacatcagagtctaggatttctagcccttggact    c.*780

         .         .         .         .         .         .    g.39314
ccagggcatacaccagtggcctcccgaaggatctaaggattttggccttgaactaagaat    c.*840

         .         .         .         .         .         .    g.39374
tacaccatcggcttccctgggtcttaggtttttgggctggattaagtcctgcttccagca    c.*900

         .         .         .         .         .         .    g.39434
tttcagggtctctgctgtgcagatggcctgttgtggaacttctcaacctccattatcaga    c.*960

         .         .         .         .         .         .    g.39494
tgcattaattcctccaataagtcccatttcatatatagtcatttaccccacaacatttca    c.*1020

         .         .         .         .         .         .    g.39554
gtcaagggaacagcatataagatggtggccgtccagtaagctaaggttaatttattaatt    c.*1080

         .         .         .         .         .         .    g.39614
atttaatttatttaccttgagttcaagtcacaattaaagtacatatacctttggaaattt    c.*1140

         .         .         .         .         .         .    g.39674
ggacttttgtatataaaagtacttttttttggcgggggcagtgggcagctctcatcctaa    c.*1200

         .         .         .         .         .         .    g.39734
acaaatgtgttatttggtacctatgcaaagatttggttaaaagaaagaaaagaattgctt    c.*1260

         .         .         .         .         .         .    g.39794
ccataaatggagcattttcttagaaaaactggagcccatctaaatgtttttcaaggtcac    c.*1320

         .         .         .         .         .         .    g.39854
gtgatctgagataatctttagtaaatagaaagctagtttaagtttcttggtttaattaaa    c.*1380

         .         .         .         .         .         .    g.39914
acagacaattcttaagagttgtcaacattatttacagttcacacatacaacttctacctg    c.*1440

         .         .         .         .         .         .    g.39974
gatttactaatcaaaacacttacgtgtggccgggcatggtggctcacgcctgtaatccca    c.*1500

         .         .         .         .         .         .    g.40034
gcactttgggaggccgaggtgggtggatcacagggtcaggagatcaagaccatcctggtt    c.*1560

         .         .         .         .         .         .    g.40094
aacacggtgaaaccccgtctctactaaaaatacaaaaaattagccgggcgtggtggtggg    c.*1620

         .         .         .         .         .         .    g.40154
tgcctgtagtcccagctactcgggaggccgaggcagcagaatggcgtgaacctgggaggc    c.*1680

         .         .         .         .         .         .    g.40214
tgagcttgcagtgagccgagatcgtgccactgcactccagcctgggtgacagagcgagac    c.*1740

         .         .         .         .         .         .    g.40274
tccgactcaaaaaaaaagaacacttatgtgtctttaagatcataaaactgtaaattcaac    c.*1800

         .         .         .         .         .         .    g.40334
tgaagaacaaaatgcacaaggaaaagataaatttcttgatatatatgaaacacaagaaag    c.*1860

         .         .         .         .         .         .    g.40394
aaaaagaagattgaaaagagccatatgttttcaatgtatgtttctttgtattttgtgtgt    c.*1920

         .         .         .         .         .         .    g.40454
ttttatgtgtttatttttgtgtttttttatgttatgtgatgtttgtgtatttttgatatt    c.*1980

         .         .         .         .         .         .    g.40514
tttataagatgtctacctccttttttttttttttgagacagagtctcttgtcacccagac    c.*2040

         .         .         .         .         .         .    g.40574
tggagtgcagtggcaacgatctccactcactgcaagctccgcctcctgggttcacaccat    c.*2100

         .         .         .         .         .         .    g.40634
tctcctgcctcagcctcctgagtaactgggactacaggcacccaccaccaaacctggcta    c.*2160

         .         .         .         .                        g.40680
attttttgtatttttagtagagacagggtttcaccgtgttaaccag                  c.*2206


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center