tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 9354 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18112
gtacattctaagactgatctctaatcctttacacctctcttttccttaccctatactata  c.403+60

         .         .         .         .         .         .  g.18172
tacaaaaattatctcaaaattcatcaataacattccttttccatgttcttcaagttttct  c.403+120

         .         .         .         .         .         .  g.18232
gtttcctacagtttctggttcttctattcaacagatacttattgatcctttgccaaatcc  c.403+180

         .         .         .         .         .         .  g.18292
aaggttatgaagctttatccccatgttttctcctaagagttttgtactttaactcttgat  c.403+240

         .         .         .         .         .         .  g.18352
gcattttcagttaatttttgtaaatggcatcagataagcgtccaactgcattcttttgca  c.403+300

         .         .         .         .         .         .  g.18412
tgtggctatccagttgccattcgttgaaatgatgatttttcccattaaatggccttggca  c.403+360

         .         .         .         .         .         .  g.18472
tccttgtcaaaaaccaattgaccataaaggtatgggtgtatttttggactctcaattctt  c.403+420

         .         .         .         .         .         .  g.18532
ttccattgatctatatctgtcctctttccagtgccacacagtcttgtagtgagttttgac  c.403+480

         .         .         .         .         .         .  g.18592
atcaggaagtatgaatctttcttttttgttttccttttccagaattattttgtttatgct  c.403+540

         .         .         .         .         .         .  g.18652
gggctttttgaaattccatattaattttaggatcagcttgccaatttctaaaatcagctg  c.403+600

         .         .         .         .         .         .  g.18712
agtttctcacagggattgtgttgcacctgttgctcagtttagaggttcctggcatcttaa  c.403+660

         .         .         .         .         .         .  g.18772
caatgagaagtcttttgatcccaaagcatgagtttttttgatttatttaaatcatctcta  c.403+720

         .         .         .         .         .         .  g.18832
atttttaaaataatgtttcgtagtttgcagactataaattttgggttgattttgttaaac  c.403+780

         .         .         .         .         .         .  g.18892
ttattcctagatatttaatacttttttatgctattgtggataaaaccttttcttaatttc  c.403+840

         .         .         .         .         .         .  g.18952
attttaggattcattgtgagtgtatacaaatataattgatttttgtacattgatcttgta  c.403+900

         .         .         .         .         .         .  g.19012
ttctataaccttgcagaacttgtttgttattcttaatgtttttataatggcttccttagg  c.403+960

         .         .         .         .         .         .  g.19072
atttcctctatataagaaaatataatttgcaaatagagaaagttttaccttttcttttcc  c.403+1020

         .         .         .         .         .         .  g.19132
aatctggatgctttttatttctttttcttacctaattgtcctggctagagcctccagtac  c.403+1080

         .         .         .         .         .         .  g.19192
catattgaataaaagtagtgaaaacagatatcttttttggagaacatctttcagttgttc  c.403+1140

         .         .         .         .         .         .  g.19252
accattaaatataatgttagctgtgggtttttgtagatattctttatcaggttgaggaag  c.403+1200

         .         .         .         .         .         .  g.19312
ttcacttttattcctagattattttgtgatttttatcatgaaagggtgttggagttagta  c.403+1260

         .         .         .         .         .         .  g.19372
aaatgctttctctgtgtttttgagataatcatgtgacttttggttttcattctattgata  c.403+1320

         .         .         .         .         .         .  g.19432
taatttgttacatcaatttattttgggatgttgaaccaacctttcattcctaggataaaa  c.403+1380

         .         .         .         .         .         .  g.19492
cttatttggtcctggtatataattcttttttgttttgttttgttttttgtttttgagatg  c.403+1440

         .         .         .         .         .         .  g.19552
gagtctcactctgttgcccaggctggagtgcagtggcgcgatctcggctcactgcaagct  c.403+1500

         .         .         .         .         .         .  g.19612
ctgcctcccgggttcacaccattctcctgcctcagccttccaagtagcagggactacagg  c.403+1560

         .         .         .         .         .         .  g.19672
cgcctgccaccacgcccagctaattttttgtattttttagtagagacggggtttcaccgt  c.403+1620

         .         .         .         .         .         .  g.19732
gttaaccaggatggtctagatctcctgaccttgtgatctgcctgcctcagccttccaaag  c.403+1680

         .         .         .         .         .         .  g.19792
tgctgggattacagtcgtgagccaccgtgcccagcctataattctttttgtatgcttgtg  c.403+1740

         .         .         .         .         .         .  g.19852
gattcaacttgctagtattttgttgcaaatttttgcaacaatattcataagaatcgttag  c.403+1800

         .         .         .         .         .         .  g.19912
tctgtagttttctttctttatgaggtccttttctggtcttcatattaagctaattgtatt  c.403+1860

         .         .         .         .         .         .  g.19972
agtccgtttatatggtgctgataaagacatacccaaagctggcaatttacaaaagaaaga  c.403+1920

         .         .         .         .         .         .  g.20032
ggtttaattggacttaacagttccatgtggctgcagaagcctcacaatcatggcagaaga  c.403+1980

         .         .         .         .         .         .  g.20092
caaggaagagcaagtcacatcttacttggatggcagcaagcaaagagcttgtacaggaaa  c.403+2040

         .         .         .         .         .         .  g.20152
actccaccttataataaccatcagatatcatgagacttactcactataatgagaacagca  c.403+2100

         .         .         .         .         .         .  g.20212
tgggaaagacctgcccctgtgattcagatatctcccaccaggtccctcccacaacatgtg  c.403+2160

         .         .         .         .         .         .  g.20272
ggaattcaacatgaaatttgagtgagaatgtatccaaaccctatcacccctggcccctcc  c.403+2220

         .         .         .         .         .         .  g.20332
cacatctcatgtcctcacatttcaaaaccaatcatgccttcccaacagtcccccaaagtc  c.403+2280

         .         .         .         .         .         .  g.20392
ttaactcatttcagcattagctcggaagttcaccgtccaaagtctcatgtgagacaaagc  c.403+2340

         .         .         .         .         .         .  g.20452
aagtcccttctgcctatgagcctataaaatcaaaagcaagttagttacttcctagatata  c.403+2400

         .         .         .         .         .         .  g.20512
atgggggtacaggcattggataaatacatccattccaaatgggtgacattgtcgaaaaca  c.403+2460

         .         .         .         .         .         .  g.20572
aagggctacaggccccatgcatgtttgaaatccagcagggcagtcagatcttaaagctcc  c.403+2520

         .         .         .         .         .         .  g.20632
aaaatgatctcgtttgactccttgtcttacatccaggtcacactgatgcaagaggcgggt  c.403+2580

         .         .         .         .         .         .  g.20692
tcccatagtcttgggcagctccgcccctgtggcattgcaaggtatagcgcccctcctggc  c.403+2640

         .         .         .         .         .         .  g.20752
tggtttcacgtgccggtgttgagtgtctgcagcttttctaggtgcacggtgtataagtta  c.403+2700

         .         .         .         .         .         .  g.20812
tcagcagttctaccattctggggtctgaaggacaatggccctcttttcacagctccacta  c.403+2760

         .         .         .         .         .         .  g.20872
ggcagtgccccagtagggactccgtgtgggggctctgatgccacatttcccttccacact  c.403+2820

         .         .         .         .         .         .  g.20932
gccctagcagaggttctccatgagggccctgcccctacagcaaacttttgcctgggcatc  c.403+2880

         .         .         .         .         .         .  g.20992
caggcgttttcatacatcttctgaaatctacgtggaggttcccaaacctcaattcttgac  c.403+2940

         .         .         .         .         .         .  g.21052
ttctgtgcacctgcaggcttaacaccatgtgggagctgccaaggcttggggcttccacct  c.403+3000

         .         .         .         .         .         .  g.21112
ctgaagcaacagcccaagctgtaccttggccccttttagtcacagctggagtggctggaa  c.403+3060

         .         .         .         .         .         .  g.21172
tgtagggcaccaagtccctagactccacacagcacaagaccctggactcctaccaggaaa  c.403+3120

         .         .         .         .         .         .  g.21232
ctattttctcctaggccttcgggcctgtgatgggaggggctgccatgatgacctctaaca  c.403+3180

         .         .         .         .         .         .  g.21292
tgccctggagacattttccccattgtcttggggattaacactcagctcctcattacttat  c.403+3240

         .         .         .         .         .         .  g.21352
gcaaatttatgcagccatctttaatttctcctcagaaaatgggttttcttttctagcaca  c.403+3300

         .         .         .         .         .         .  g.21412
ttgtcaggttgcagattttccaaactttaatgctctggttcccttataaaactgaatgcc  c.403+3360

         .         .         .         .         .         .  g.21472
ggccaggcgcggtggctcatgcgtgtaatcccagcactttgggaggccaaggcaggtgga  c.403+3420

         .         .         .         .         .         .  g.21532
tcatgaggtcaggagattgagaccatcctggcgaacacggtgaaaccccgtctctactaa  c.403+3480

         .         .         .         .         .         .  g.21592
aaatacaaaaaaattagccaggcatggtggtgggtgcctgtagtcccagctactcaggag  c.403+3540

         .         .         .         .         .         .  g.21652
gctgaggcaggagaatggtgtgaacccaggaggcggacttgcagtgagccgagatcatgc  c.403+3600

         .         .         .         .         .         .  g.21712
cactgcactccagcctgggcaacagagcaagactctgtctcaaaaacaaaaaacaaaaca  c.403+3660

         .         .         .         .         .         .  g.21772
aaacaaaaaaagaattatataccaggaccaagtaagttttatcctaggaatgcaacattg  c.403+3720

         .         .         .         .         .         .  g.21832
gttaaaaacaaagaaacaaacaaataaacaaaaaaactgaatgccttttacagcactcaa  c.403+3780

         .         .         .         .         .         .  g.21892
gtcaccccttgaatgcattgctgcctagaaatttcttctgccacataccctaaatcacct  c.403+3840

         .         .         .         .         .         .  g.21952
cttcccagttcaaagctccacagatctctagggaagggacaaaatgccaccactctcttt  c.403+3900

         .         .         .         .         .         .  g.22012
gctttctttgctaaaatataacaagagtcacctttgctccagttcccaataagttcctca  c.403+3960

         .         .         .         .         .         .  g.22072
tctccatctgagatcatctcagcctggactttattgtccatatcactattaggcttttgg  c.403+4020

         .         .         .         .         .         .  g.22132
tcaaagccattcaacaagtctctaggaagttccacactttcccacattttcctatcttcg  c.403+4080

         .         .         .         .         .         .  g.22192
tctgagccctccaaactgttccaacctctgcctgttatgcagttccaaagttgcttccat  c.403+4140

         .         .         .         .         .         .  g.22252
attttcaggtatcttttcagcagctccccactctactggtaccaatttactgtattagtt  c.403+4200

         .         .         .         .         .         .  g.22312
tttttttttttttttcgtgctgctgatgaagacattcccaagactgggcaatttacaaag  c.403+4260

         .         .         .         .         .         .  g.22372
aaagaggtttaattgaacttacagttctacgtggctggggaagtcttacaataatgatgg  c.403+4320

         .         .         .         .         .         .  g.22432
aaggcaaggaggagcaagtcatgtcttacatggatggcagcaagcaaagagagcttgtgc  c.403+4380

         .         .         .         .         .         .  g.22492
aggaaaactcccccttataataaccatcagatcttatgagacttactcattatcatgaga  c.403+4440

         .         .         .         .         .         .  g.22552
actgcaagggaaagacctgccccacatgattcaattacctcccattggatccctcccaca  c.403+4500

         .         .         .         .         .         .  g.22612
acttacgggaattcaagatgagatttgtgtggggacacagccaaatcatatcagtaatat  c.403+4560

         .         .         .         .         .         .  g.22672
tgtccttatacaatgaattggaaagtgctccttcctctgctgtctttaaaaagggtttct  c.403+4620

         .         .         .         .         .         g.22729
gaataattggtattaattcttcttgaaatggttggtatcattcagtggtaaaggcat  c.403+4677

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.22786
   ctgggcctcaactttgtttttctggtgaaaacatatacatgtatttagaattagcca  c.404-4621

.         .         .         .         .         .           g.22846
gctggattcagtttagatgatcccaattttgttggcaacatccaagacatggtaatcagg  c.404-4561

.         .         .         .         .         .           g.22906
agccagtcgaacatatgccttcttctctccatcaggcctaatcagggtgttgaaccttgg  c.404-4501

.         .         .         .         .         .           g.22966
ccacataaacatcatagagcttcttcacaacctgtttgatctggtgcttgttggttttaa  c.404-4441

.         .         .         .         .         .           g.23026
catctacaatgaacacaagtgtgttgttgtcgtcttctatcttcttcatggcatactcag  c.404-4381

.         .         .         .         .         .           g.23086
tggtcagtggaagcttgatgatagcatagtggtcaagcttgtttctcctgggggtgctct  c.404-4321

.         .         .         .         .         .           g.23146
ccagagtctcagtatcttgggccaccggaaggtgggtgatgtatggatattctttttttc  c.404-4261

.         .         .         .         .         .           g.23206
atggcagtggacacctttctacactgccttcttggccttcaaaacctttgcatcgcttca  c.404-4201

.         .         .         .         .         .           g.23266
gctttaggaggggcaggagcttccttctttgctttcagtgccatcttgtgaaaacgactt  c.404-4141

.         .         .         .         .         .           g.23326
ttctttaggagtagttttgataactaagtcaaaatctttacttgctatatgtctattcac  c.404-4081

.         .         .         .         .         .           g.23386
attgtctctttcatcttgattcagtttcagtagtttgtgtctttctaggaatttgcccct  c.404-4021

.         .         .         .         .         .           g.23446
ttcatccaaggtacctaattttttgttgtacaggtttcatagtattcttttataattttt  c.404-3961

.         .         .         .         .         .           g.23506
ttatttctatataatctgtagtaatgtgctctctctcatttctgattctaatacagtcat  c.404-3901

.         .         .         .         .         .           g.23566
gcctcagttaatgatgggaactcattctgacaagtgcatcattgtgcaaacatcatagag  c.404-3841

.         .         .         .         .         .           g.23626
tgtacctccacaaacctagatgatatagcctactgcatccctaggctatgtgatatagcc  c.404-3781

.         .         .         .         .         .           g.23686
tattgctcttagattacaaacctgtactagtagacaattgtaacacaatgataagtattt  c.404-3721

.         .         .         .         .         .           g.23746
gagttcctaaacatgtgaacatagaaaaggcccaataaaaatatggtataaaaggttaaa  c.404-3661

.         .         .         .         .         .           g.23806
aaagatgatgtagttgtctagggcacttaccatgaatggagcttgcaggactggatcttg  c.404-3601

.         .         .         .         .         .           g.23866
tctgggtgagtcagtgagtggtgagtgaatgtgaaggcctgggacattcctgtacactac  c.404-3541

.         .         .         .         .         .           g.23926
tatggactttataaacactgtacatttaggctacaccaaatctgtaaatttttttttcct  c.404-3481

.         .         .         .         .         .           g.23986
tccttcaatattaacttcgtgtaactattttactttataaactttttaatttttaaaact  c.404-3421

.         .         .         .         .         .           g.24046
ttttcactcgttttaacacttagcttaaaaaacaaaaactgtacagctgtacaaaaaatg  c.404-3361

.         .         .         .         .         .           g.24106
ttctttctttatattcgtattctataaacatttttgtatttttaacttaaactttttttt  c.404-3301

.         .         .         .         .         .           g.24166
acttaaaaatttttttgttaaaaactaagatagaaacacagacattggccgggcgcagtg  c.404-3241

.         .         .         .         .         .           g.24226
gctcacacctgtaatcccagcactttgggaggccaaggcaggcggatcacgaggtcagga  c.404-3181

.         .         .         .         .         .           g.24286
gatcgagaccatcctggctaacacagtgaaaccctgtctctactaaaaatacaaaaaatt  c.404-3121

.         .         .         .         .         .           g.24346
agctgggcatggtggcaggcacctgtagtcccagctactcgggaggctgaggctgaggca  c.404-3061

.         .         .         .         .         .           g.24406
ggataatcgcttgaacctgagaggcagaggttgtagtgagctgagattgcgccactgcac  c.404-3001

.         .         .         .         .         .           g.24466
tccagcctgggtgacggagtgtgactccttctcaaaaaaaaaaaaaaaaagaaacacaga  c.404-2941

.         .         .         .         .         .           g.24526
cattaacctaggtctacacaaggacaggttcatcaacatcactgtctttcacctccacat  c.404-2881

.         .         .         .         .         .           g.24586
cttgtcgcgttggaggatcttcaggggcagacacacatggagctgtcaactcctatgtcc  c.404-2821

.         .         .         .         .         .           g.24646
tctgataacaatgccttcttctggaaaactgcatgaggctgttttatagttacctttttt  c.404-2761

.         .         .         .         .         .           g.24706
atttgtaagtaggagtacactctaaaataacattacaatgtatagtatcaaaaatacata  c.404-2701

.         .         .         .         .         .           g.24766
aatcagtaagtcatttattatcattatcaaatattatatatagaacttcattatatgtgc  c.404-2641

.         .         .         .         .         .           g.24826
tatacttttaactggcagtgaagtaggtttgtttacatcagcattaccacaaacacctga  c.404-2581

.         .         .         .         .         .           g.24886
gtaacgcattgacttatgacattactaagcgataggaattttcctcctccattataatat  c.404-2521

.         .         .         .         .         .           g.24946
tatgggaccaccgtcacatatgtggttcattgttgaccgaaacgtcatcatgcagtgcgt  c.404-2461

.         .         .         .         .         .           g.25006
gactataatttgagtcttattttttccctgtgctaattttttaacacaattagttgtgcc  c.404-2401

.         .         .         .         .         .           g.25066
aatatatcgatctatttaaagaactagattttgagttcattaatttactctgttgttttt  c.404-2341

.         .         .         .         .         .           g.25126
ctgttctccgtctcattaatttctgctctaatctgtattattttcttccttctgcttgct  c.404-2281

.         .         .         .         .         .           g.25186
ttatctatagtttgctcttctttttcgagtgtcttagagtggattattaggttatagatt  c.404-2221

.         .         .         .         .         .           g.25246
gagatatttcttcttccttaatagacatttaggaaggatatttcttcttccttaatagac  c.404-2161

.         .         .         .         .         .           g.25306
aatttctctgtaaacttcagctacgttagctgtatcccataggttttggtatgttgtgtc  c.404-2101

.         .         .         .         .         .           g.25366
ttcattttcattcgtcttattttctgatttctcttttgatttctttttagaccagttggt  c.404-2041

.         .         .         .         .         .           g.25426
tatttaggagtgtgctatttaatttttatatagctgtgatgttccccagtttcttcctgc  c.404-1981

.         .         .         .         .         .           g.25486
tattgatttctaattttattccattgtggtaggagagtgtattttgtattatctctatcc  c.404-1921

.         .         .         .         .         .           g.25546
ttttaagtgtattgaggtttatcttatggccaagcatatggtttattttggagaatgttc  c.404-1861

.         .         .         .         .         .           g.25606
tatgtgcactttaaaagaatgtgtatcttgttttgattgagtagagtgttttatagacat  c.404-1801

.         .         .         .         .         .           g.25666
ctgtccagtctagttgttaatagtgttgttcaagtctactactttcttgttgatgttctt  c.404-1741

.         .         .         .         .         .           g.25726
tctagatttttttggtatgaattcctataggttaaggaaactatgctttgcagtgtggtt  c.404-1681

.         .         .         .         .         .           g.25786
ttcattgcaagtattttctcctactttgttttcatcttagtcaagatttcttccatgcag  c.404-1621

.         .         .         .         .         .           g.25846
ttttcttcctaattttcatatagttaactttatgcaactttttagtttctcgtgagactg  c.404-1561

.         .         .         .         .         .           g.25906
agaaggtcctttctctctccaaacttgtaagaaaaatttctcatgcagtacttgtgtgat  c.404-1501

.         .         .         .         .         .           g.25966
ttcatactttacagttgacaccttgatagacctagtctctatttccttatagggagagca  c.404-1441

.         .         .         .         .         .           g.26026
taagcaagaagctttattatttttcagcagtaaccttagttgccccagcgccattactga  c.404-1381

.         .         .         .         .         .           g.26086
ataatcatatttttatcatcgatagtgtcatcatcataacacatcagcaaggaagttttt  c.404-1321

.         .         .         .         .         .           g.26146
ccttcacagtggcacggtggctcactcctgtaatcccagcactttgggaggccgaggcag  c.404-1261

.         .         .         .         .         .           g.26206
gtggatcatgaggtcaggagatcgagaccatcctggtgaaacctagtgaaaccccgtctc  c.404-1201

.         .         .         .         .         .           g.26266
tactaaaaatacaaaaaattagccaggcgtggtggcacgctcctgtagtcccagctactc  c.404-1141

.         .         .         .         .         .           g.26326
gggaggctgaggcaggagaatcgcttgaacccaggaggcggaggttacagtgagccaaga  c.404-1081

.         .         .         .         .         .           g.26386
tcacgccactgaactccagcctggtgagagagcgagactccatctcaaaaaaaaaaaaaa  c.404-1021

.         .         .         .         .         .           g.26446
gcctttattatttttcagtagtaaccttagttgccccagcactattactcaataaccaca  c.404-961

.         .         .         .         .         .           g.26506
tttttataattggtagtgtcgtcatcgtaacacattatcaaggaagttttttttccacag  c.404-901

.         .         .         .         .         .           g.26566
tttgggttttctaagagtatctttcaatatcagtaaatatgaatcagaggagagggataa  c.404-841

.         .         .         .         .         .           g.26626
ataaatgggcactgaaaggggagagtgaggtcacctgaaggggcgaagccctggaggtga  c.404-781

.         .         .         .         .         .           g.26686
aggtcgagcctccagacatgggctcccgctggcgacagctcctgcaggctgtcacctcag  c.404-721

.         .         .         .         .         .           g.26746
tgcctggagaccctctgcaatccagggcagcatgaggtaggccttctttctgtggatcat  c.404-661

.         .         .         .         .         .           g.26806
tctttgactctgtatagggaggaccctttttccttccattttcctcccatggcaggtggc  c.404-601

.         .         .         .         .         .           g.26866
atgggctgtatctgaagccttcccctcatcgctgtattgtttctgcgcctgtttgtacct  c.404-541

.         .         .         .         .         .           g.26926
tctactgaccaagagctcactgagggcagggattaggactttttgtgagtttccagggat  c.404-481

.         .         .         .         .         .           g.26986
gcaggtggcattgccctggtctctaggcctatgtggccattaatcacttaaaacacagcc  c.404-421

.         .         .         .         .         .           g.27046
actttgaattgagatgtgcagtgagtgaaaaatacactctgggtttcgaacacttagtat  c.404-361

.         .         .         .         .         .           g.27106
tcaaaataaaagaaaatatctcaatgttttatcttgtttacatgttgaaatgctaatgtt  c.404-301

.         .         .         .         .         .           g.27166
ttggatattttaggtccaaaaagtacattgttaaaattaatttgacctcattctcttttt  c.404-241

.         .         .         .         .         .           g.27226
actattttaatatggctctcatagaatttgaattttgcatgtggtttgtattgtatttct  c.404-181

.         .         .         .         .         .           g.27286
gtcagcagcgccagtcagaggtgtgtatagatgcagaattgacgacaagaccaagccaag  c.404-121

.         .         .         .         .         .           g.27346
aagatgggatttctctgtctggggtctactgatggccaaaagaagagtttcctagccacc  c.404-61

.         .         .         .         .         .           g.27406
gccacgatcctctgggaactctgtggcaattcattcattggcttttctctcccttcccag  c.404-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center