tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 728 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.27580
gtacagaatgtgtggacctcttgtccagaggtggagtgaggggcagtgaggtgggagtgg  c.517+60

         .         .         .         .         .         .  g.27640
tagccaatgtgagtcagggaaccaagttccagcccaacttggtcttcatcataccctgtt  c.517+120

         .         .         .         .         .         .  g.27700
ccatggttatgtcttaggtccataaaatgaaacagaaagaaatcatttttataatgcatg  c.517+180

         .         .         .         .         .         .  g.27760
ccacctggtagtgcaaactatcagctccaagagggtaggggcatcattacagcacaaaga  c.517+240

         .         .         .         .         .         .  g.27820
aggcctggctgagtggacagggctgagtttcagcggtggtacgggtctgctctggggcca  c.517+300

         .         .         .         .         .         .  g.27880
cgctccccctgggctgtgtgctcctggcaggttctcaggctcactcagccttcagtttct  c.517+360

      g.27884
cagg  c.517+364

--------------------- middle of intron ---------------------
                                             g.27885          g.27888
                                             c.518-364  cgcc  c.518-361

.         .         .         .         .         .           g.27948
tccctcttcctcagcaggctgggtttttgggaagtcacccaagggctcctcttcttgcag  c.518-301

.         .         .         .         .         .           g.28008
actctctcacataccatgtgcctcctttgctactgaccatgcgatctaaatggtgctttt  c.518-241

.         .         .         .         .         .           g.28068
tccctaatctgatgtaataaataatgaatcatggtccttttgtatgactccaagtgttgg  c.518-181

.         .         .         .         .         .           g.28128
tgacagctgaagggtgggtgtcctgtgtgagcccgagtgtgctggtgcagaatctggccc  c.518-121

.         .         .         .         .         .           g.28188
tcagaactccttggcaaactgagttgagctgagctgagggggagggagttggggtggtga  c.518-61

.         .         .         .         .         .           g.28248
ggaaaggtcaagggacacgtcagggaaacacattcccaaaaccttgtactctgtcatcag  c.518-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center