tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 1047 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.28420
gtgagacaacagccaaggggctcccagcagcctcaaagaacccacagaagcaaggaaccc  c.629+60

         .         .         .         .         .         .  g.28480
taaaaagacccgagtctccttgtacccgtatctatcagccctgaccccatggtgcctcca  c.629+120

         .         .         .         .         .         .  g.28540
cccccataggtgtccctgagcctgtggcgtctcctgagcctgcaacctgcccctcctggt  c.629+180

         .         .         .         .         .         .  g.28600
ccatctgcctgtccccacccctgtcccctgcagtggccccttctcacccctccccagcac  c.629+240

         .         .         .         .         .         .  g.28660
tagtccccttggccaggctgacttgttcactaggcacaggaggccatgacttagggccca  c.629+300

         .         .         .         .         .         .  g.28720
caacagaggtacatgaaatattttatcttgaaatcataagaaaataatggtatagaatcc  c.629+360

         .         .         .         .         .         .  g.28780
agctggggttatatttatatttaaacaaattgagtcataaaatgtaatttttaatatttg  c.629+420

         .         .         .         .         .         .  g.28840
cttttaattcaagaagacagaaatgcccacagcccgcaaaaatcataataaggccatggg  c.629+480

         .         .         .         .      g.28884
tggagctccttcaagttcccatgaggacctgagcccacccagcc  c.629+524

--------------------- middle of intron ---------------------
      g.28885       .         .         .         .           g.28927
      c.630-523  agcctcacccctggcccctgatttctcaataagtcctgtcttt  c.630-481

.         .         .         .         .         .           g.28987
ttcctattttggttttggaagcaaagagtaattgctcttctctggtcctccagtgtttgc  c.630-421

.         .         .         .         .         .           g.29047
tgtgattgagaggaaccagcagacaggtgggggcgagggctcacttgtactgtgggttaa  c.630-361

.         .         .         .         .         .           g.29107
ctggaggaaggggctcagcttgtggccacacgggcttgtgatcttcccctggagtgtgat  c.630-301

.         .         .         .         .         .           g.29167
tcctcctaacgcaggcctcccctgcagcccagggaagattagtgtgtgcccagcacagaa  c.630-241

.         .         .         .         .         .           g.29227
ggctcctggaactgcagctctgaccccagagcagggaggccaagggggtaaagtgtgcat  c.630-181

.         .         .         .         .         .           g.29287
gctcagacccttccccagcctaaacaagggagcatagggggaccccctgcagatacgagg  c.630-121

.         .         .         .         .         .           g.29347
agactatccttcccctgacgccttctcagggacattgggcagggagagtggctcctcttt  c.630-61

.         .         .         .         .         .           g.29407
catcccacctggccagctttccatcaagagtcccccccctccctccctgtgtgtacccag  c.630-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center