tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 86 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .     g.29524
gtacaaagcccactggggaagccccagctgcagaggagacagg  c.703+43

--------------------- middle of intron ---------------------
       g.29525      .         .         .         .           g.29567
       c.704-43  gaccagcagcccgagactcctgtcttttcctgtcttttctcag  c.704-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center