tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 587 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.29723
gtaggtgctggctgagggcaagggctctgggcactctctgccctgccttcttctgttccc  c.799+60

         .         .         .         .         .         .  g.29783
acagacagaaacgctcacccctgccccaagtcctagtgtctctggccgggctctatcttc  c.799+120

         .         .         .         .         .         .  g.29843
ctccttgtgatcaccccccatcctcccatcctgtgcaaccctagggccctggtgtcatcc  c.799+180

         .         .         .         .         .         .  g.29903
gtccctctcccaaggctgggggtcccctcatctcccagccaagtctgggaaggcagggcc  c.799+240

         .         .         .         .         .      g.29957
agttcctccactggtcaggcccatccaggcagggggcagtcagctcctcaactg  c.799+294

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.30010
       gatgacaagagtcgagacgagaagtggttgtgggatttatgtagctttgttca  c.800-241

.         .         .         .         .         .           g.30070
gagcaaaacacagagcagaaaacagtgatgttccacttgtttgtttttagcctacttccc  c.800-181

.         .         .         .         .         .           g.30130
tttatgctccccgctcctgaaggatctcccgagttagcagggcctcatgtggatccccag  c.800-121

.         .         .         .         .         .           g.30190
gcccggggatctttgtccagtgtcccagcccccagcccacccctgcccaacactgccctc  c.800-61

.         .         .         .         .         .           g.30250
taagaaggagtgctgcatgggcccctccctggccactaagggaaccgtcttctcttctag  c.800-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center