tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 437 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30342
gtgagttgatttctccaggagctgggggcatcaggggctcaggaactgcttcttgcccac  c.831+60

         .         .         .         .         .         .  g.30402
agtgtagtccaggtgggtgggtccccgtgctctcatggctgccctgagtctctgaagtgg  c.831+120

         .         .         .         .         .         .  g.30462
cctggatgctgtgcattgactatgggggacacaggcccttttgagcatcatacaggctgg  c.831+180

         .         .         .           g.30501
tgggccattctgtagccctgtgcttcctacagcccaggt  c.831+219

--------------------- middle of intron ---------------------
           g.30502            .         .         .           g.30539
           c.832-218  gagacccttaccccacagcctgtaccctggggatgggg  c.832-181

.         .         .         .         .         .           g.30599
tgagcccccaagcccagcaccagggcctggccccagcagcaggtcctggatgtgctgagc  c.832-121

.         .         .         .         .         .           g.30659
atggacttcctggagtgacctcactgggagggggtggtggcagcaggtccagccgtgccc  c.832-61

.         .         .         .         .         .           g.30719
tacggaccccgtggggagccctgggtgtgggcttctgagttggctctttgccttcctaag  c.832-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center