tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 2061 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30962
gtgagttggggacaggcccctccaagaccttgtaggcagggggtgaaggccatgcctcgg  c.1014+60

         .         .         .         .         .         .  g.31022
ctctcctggtcaaaggggaagtggagcctgagggagatgggactgcaggggacggggctg  c.1014+120

         .         .         .         .         .         .  g.31082
cgtgggaaaaagcagccaccctcacaaggggacaggcactcttccaaatgtctgcttctt  c.1014+180

         .         .         .         .         .         .  g.31142
agtccctgtcctgtccttgccatgtcctcagaaactggagctccagaggaatagagtggg  c.1014+240

         .         .         .         .         .         .  g.31202
ggtcacagggtttgttgatgactgaataaggctgcacggtctccactgtgtgctcctaca  c.1014+300

         .         .         .         .         .         .  g.31262
gaagttagggagcccttgctcataacagcagggattttaaatttactctgaaattattat  c.1014+360

         .         .         .         .         .         .  g.31322
tgcattaaacatatttggatctaaatctctgcccaaatttctgcatatggttgtatggag  c.1014+420

         .         .         .         .         .         .  g.31382
gattccaagaagaagcacaatttccaagtcagcctgtaacagtgctgcttactgtgtaca  c.1014+480

         .         .         .         .         .         .  g.31442
cgcacatacacgcacatgcacacacatgcatgtacacacatgcacacacacatgcacgta  c.1014+540

         .         .         .         .         .         .  g.31502
cccacacatacaggtacacacatgcacacagccccctagtgttggtttgtaccagttcat  c.1014+600

         .         .         .         .         .         .  g.31562
gtattttgatttgacattgaagggctttttcttttctttttttttcttttttttgctatt  c.1014+660

         .         .         .         .         .         .  g.31622
taggaaaacattgttttaaacgaacatttctttgttttcactgtttttgcgtaagatcag  c.1014+720

         .         .         .         .         .         .  g.31682
tgtcttgtctctcagagtctttatgagaaggcctgctctcctactcatgctttttctcac  c.1014+780

         .         .         .         .         .         .  g.31742
attcagacagtagattcctaatttcttcttgcccctttttgttctaatattttcaggtgt  c.1014+840

         .         .         .         .         .         .  g.31802
agaagctttaatttttaaccagtgaaatctgtagatacttttaccttttcattgctcact  c.1014+900

         .         .         .         .         .         .  g.31862
actgtagaaagaccttttgccaacacaagacgaactcctctaacttcttatggagatatt  c.1014+960

         .         .         .         .         .         .  g.31922
tttttcaatgatgtgatttttgcatataactttataatctaaatggaacttgttttgtgt  c.1014+1020

         .   g.31933
ttcagtgcaaa  c.1014+1031

--------------------- middle of intron ---------------------
                                     g.31934      .           g.31943
                                     c.1015-1030  gcgaggcact  c.1015-1021

.         .         .         .         .         .           g.32003
ccctgaattgttctagtcactgtctggtttttccaacccctttgagctgccgattctccc  c.1015-961

.         .         .         .         .         .           g.32063
atttccctctgctttgggtccctccttaatcacaggttaaatgctcatctagacaatgat  c.1015-901

.         .         .         .         .         .           g.32123
ctccttccacctagactgttccattcagttcctttcttgcattagtacccatttattcta  c.1015-841

.         .         .         .         .         .           g.32183
accaaaaatgtaattaaaaaaaaaagaaggcaaacattaaaaaggtcaataatctccagc  c.1015-781

.         .         .         .         .         .           g.32243
ttgataaggtgctttgacatgaacaaatagtttatatatttaaaatgagaaaatttaaac  c.1015-721

.         .         .         .         .         .           g.32303
tatcaaaaggtactcagtaagtaaagagagcatcctccactctgcagtgccctgggtctt  c.1015-661

.         .         .         .         .         .           g.32363
tttcctcaagtaactatgagatatcatttcttgtgattctttgtccaaatctatgcatca  c.1015-601

.         .         .         .         .         .           g.32423
gtgtatgtgtatacaaaagacattatattattaacgaatggtccccaaccttttggcacc  c.1015-541

.         .         .         .         .         .           g.32483
agggaccagttttgtggaagacaatttttctatggactgggaggtgaagatggtttgggg  c.1015-481

.         .         .         .         .         .           g.32543
atgattcaagcacattacgtttattgtgtactttatttctattcttatcacattataata  c.1015-421

.         .         .         .         .         .           g.32603
tataatgaaataattatacaacttatcataatgtagagtcagtgggagccctgagcttgt  c.1015-361

.         .         .         .         .         .           g.32663
tttcctgcaacgagatggtcctatctgagggtgatgggagacggtgacagataatcaggc  c.1015-301

.         .         .         .         .         .           g.32723
ataagattctcataaggagtatgcaacccagatccctgacgtgcacagttcacaataggg  c.1015-241

.         .         .         .         .         .           g.32783
tttgcactcctataagaatctaatgttgccactgatctgaccgggtggagctgaggtggt  c.1015-181

.         .         .         .         .         .           g.32843
aatgccagcaatggggagtggctgtgagctatgtgggaccagaggtttttcaccatctcc  c.1015-121

.         .         .         .         .         .           g.32903
atggtgacccaagggggaaagtgatgtgctgcaggtttccgggctggctgatggtcagag  c.1015-61

.         .         .         .         .         .           g.32963
tcagtactagactgcaggacccctgactcagaccaaggcattccccactgtgtgttacag  c.1015-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center