tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) - 5118 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.33096
gtaagtgttttgctcctggagatgcagcagaaatggtgggaatagggacggtgtcctaac  c.1087+60

         .         .         .         .         .         .  g.33156
tggtgtccccattgctgagagtgctcttccagagcattccatgccagaaactgggggtcc  c.1087+120

         .         .         .         .         .         .  g.33216
tatgctatagaccatcaagaccctaaattgtcttctcccatctcttcttcccactctacc  c.1087+180

         .         .         .         .         .         .  g.33276
tcatcctttctgcaccctattaatgacactagccactctgtctatcctcttctccacctc  c.1087+240

         .         .         .         .         .         .  g.33336
ctctcttctcctttgttgttcaggagaacaacagccctgaggggctgccctgtcctgcat  c.1087+300

         .         .         .         .         .         .  g.33396
ggcaccactgacttcagtgggctaatagctctttatctgtgcctaagcccaatttgcaga  c.1087+360

         .         .         .         .         .         .  g.33456
gctgttgtataaactacatactgattccaaagacttaatgcaagaaagaatggaaaatat  c.1087+420

         .         .         .         .         .         .  g.33516
tccactcattattttgttaccgaaacaccaggtgttgggtctaggtcttggtgctcactg  c.1087+480

         .         .         .         .         .         .  g.33576
cacagagggccaatcactgagacaattagtattgacaaggaagaatactttcattgagtg  c.1087+540

         .         .         .         .         .         .  g.33636
ctgtaggcaaggagatgggagctcagtctccaattcatgtcccctgatggactaaaacta  c.1087+600

         .         .         .         .         .         .  g.33696
ggggtttatatagtagggataaaatgtaacaatgtgggccgggcacggtggcttatgcct  c.1087+660

         .         .         .         .         .         .  g.33756
gtaatcccagtactttgggaggccgaggcgggcgaatcacaaggtcaggagatcgagacc  c.1087+720

         .         .         .         .         .         .  g.33816
atcctggctaacatggtgaaaccccttctgtactaaaaatacaaaaaaaaattagccagg  c.1087+780

         .         .         .         .         .         .  g.33876
cgtattggcgggcgcctgtagtcccagctattcgggaggctgaggcaggagaatggcatg  c.1087+840

         .         .         .         .         .         .  g.33936
aacccgggaggcagagcttgcagtgagccaagatagcgctactgcactccagcctgggtg  c.1087+900

         .         .         .         .         .         .  g.33996
acagagcaagactctgtctcaaaaaaacaaaaaagtaacaatgtgtaagaaaacaggaac  c.1087+960

         .         .         .         .         .         .  g.34056
tagggaggggtaaggaagcaatcaagatgaatgaggggtccagcatcccattggatgtag  c.1087+1020

         .         .         .         .         .         .  g.34116
tgatttgtaagtttcagttctttgatactttgagaggcctgaaggtcatttcctgaaaaa  c.1087+1080

         .         .         .         .         .         .  g.34176
ggaactcagataaaacaaatgtaagatttgagctttaagaacagaagggtcaatttctat  c.1087+1140

         .         .         .         .         .         .  g.34236
gtttatcaaaacaacaacaacaacaaaaaaaccttttgatggacatattgggttgatttc  c.1087+1200

         .         .         .         .         .         .  g.34296
agttctccctttctatttatcaatcccacagtcacagagagtctggtcctggatctttct  c.1087+1260

         .         .         .         .         .         .  g.34356
ggctgcttcatggttgaggaggggcatcatgggaagcttcacataccatgggtgacctca  c.1087+1320

         .         .         .         .         .         .  g.34416
tggccacccaggaatcaaaggttaatttaatactaaaagattgtgtttcttctgaaacac  c.1087+1380

         .         .         .         .         .         .  g.34476
aatctctctctctcggccccacttccaccaaagacaaattatagcaggaccaatgtacct  c.1087+1440

         .         .         .         .         .         .  g.34536
gcaaaataagtttagttccatatacgtggcctgattacccacacaaagtgcagcaaaaat  c.1087+1500

         .         .         .         .         .         .  g.34596
cactgtccacataggctctcctaagttggctttgctggaacctctcacgaggccattgca  c.1087+1560

         .         .         .         .         .         .  g.34656
atcaaagccctgagaaaataaccattttatccaactgtgttccattgtaaaagaaaacgt  c.1087+1620

         .         .         .         .         .         .  g.34716
tgttattaaccatatgtaagcaaacacattgccatgaattaatagtcacaaataatttaa  c.1087+1680

         .         .         .         .         .         .  g.34776
aaattctagagaaattaggcagagagagaaatatgcctcaaattctgtttacaaaagtat  c.1087+1740

         .         .         .         .         .         .  g.34836
actcaatatacttaaagtatacttaaaggctataaatagcaaagaagaaaaaagttctcc  c.1087+1800

         .         .         .         .         .         .  g.34896
agactggaaaacaaaaccaaaagaatcagcaatatttcaaaccaacaaaagccatacgaa  c.1087+1860

         .         .         .         .         .         .  g.34956
ttatttcagtcctctattagttcagtccactcaatcagctcctgcccagcttcatgtttg  c.1087+1920

         .         .         .         .         .         .  g.35016
gttaacaatcacaatctttatgaacacatcagtctttcttctttttttgttttgagacag  c.1087+1980

         .         .         .         .         .         .  g.35076
agtctcactctgtcacccacgctggagtgcagtggtgcaatctcatctcactgcaacctc  c.1087+2040

         .         .         .         .         .         .  g.35136
cacctcctgggttctagcaattctcacgcctcagcctcctgagtagctgggaccacaggt  c.1087+2100

         .         .         .         .         .         .  g.35196
gtgcaccaccacatctgggtactttttgtatttttagtagagacagggttttgccacgtt  c.1087+2160

         .         .         .         .         .         .  g.35256
ggccagtctggtctcaaactcctggcctcaagtgatagacattcgcctgccttggcctcc  c.1087+2220

         .         .         .         .         .         .  g.35316
caaagtgctgggattacagacatgagccaatgcgcctggccacacattggtctttcagtt  c.1087+2280

         .         .         .         .         .         .  g.35376
actgcactggaagttttctctgtaatccaatgacaacaatttttaattatatgaaaaatt  c.1087+2340

         .         .         .         .         .         .  g.35436
tacttaaaacatcccatttacatttactcaattctttcatttttaagtttatccagattg  c.1087+2400

         .         .         .         .         .         .  g.35496
cttctgaaaattgagatattagacaccatcatttaaagttagttaatttctttgtcagcc  c.1087+2460

         .         .         .         .         .         .  g.35556
atttttttaatagccagtgaacatcaggtgctcacctaagagcttcaaagttaaatatat  c.1087+2520

         .         .         .           g.35595
agatattttcaccaataagtcagaagactcagctgtttt  c.1087+2559

--------------------- middle of intron ---------------------
        g.35596               .         .         .           g.35634
        c.1088-2559  cattaaaccaacaacattaatttaatcttacttatcaaa  c.1088-2521

.         .         .         .         .         .           g.35694
agcttgactcaaagatcattttgttttggttgggcttgtagtcttaagtttttgtgccaa  c.1088-2461

.         .         .         .         .         .           g.35754
actgatatctcaaaatatctagcaaagacaaatataagcccagacaaaaatgtatgctga  c.1088-2401

.         .         .         .         .         .           g.35814
caattctgaagacacttctgttttcttattttaccaataattttaaagctgacttgttta  c.1088-2341

.         .         .         .         .         .           g.35874
gtaaggatttacttaagtcacatgaacttgaaaattgcttggaattatttactttattta  c.1088-2281

.         .         .         .         .         .           g.35934
tgagtactcttttacttataagtcaatttggtagacacaacatgtaacttaataataaat  c.1088-2221

.         .         .         .         .         .           g.35994
gtacatacacataaacacatctagacctatatgcacacacaaagatccaatagcttttac  c.1088-2161

.         .         .         .         .         .           g.36054
ctttgaactctctccatgagacagtaatacaaactcaccagtctacaaatatgttcacat  c.1088-2101

.         .         .         .         .         .           g.36114
ggctgaaatttgttagctccaatagataattcagtgaaggttgtgaacccaaattttagg  c.1088-2041

.         .         .         .         .         .           g.36174
taaagcagtttccatggcagtttgatttttaaaggccaaacctctgcagactccaaacag  c.1088-1981

.         .         .         .         .         .           g.36234
catcgcagagaacaccacctagaaccaactaatcaggcccaatgctgcttagaacagcaa  c.1088-1921

.         .         .         .         .         .           g.36294
cataaaagcctggatacaggaactccatcctactttctcattcagcagcaaacttcagtt  c.1088-1861

.         .         .         .         .         .           g.36354
tccaagcaatattggagccaaacagtattacaaaagaataccaagtttactgaattccaa  c.1088-1801

.         .         .         .         .         .           g.36414
tttcccatgactctagcaaacacatagaaataatcaccaaaacataatacaactgctgca  c.1088-1741

.         .         .         .         .         .           g.36474
gcaacaaacaagctccaagagtgtccagactgaaacaggcagggtgcttcctctctccat  c.1088-1681

.         .         .         .         .         .           g.36534
tggttaggtttgatcaacctgccaacaaaaattgctttcaaatttctcaaattgagagga  c.1088-1621

.         .         .         .         .         .           g.36594
gccagtcgtgctgcctggtacccacaaaagacactcacttgccctgaaacaacacacaat  c.1088-1561

.         .         .         .         .         .           g.36654
tacaaacaagcctccaagagtgtccagactgaaaggcagagtgcttccctctcacagtca  c.1088-1501

.         .         .         .         .         .           g.36714
cttgggcctgttcaacctgcaaatggaaattcctttaaaaatttctcaaactgagaagag  c.1088-1441

.         .         .         .         .         .           g.36774
cagatcctgctgtctgggcccacaaaggacaatcacctgtctggatgcaaatgtcaaatt  c.1088-1381

.         .         .         .         .         .           g.36834
tcaaaggcagttcttcggaagtaatcaggaatgtggttggggccggctgcagtgggacct  c.1088-1321

.         .         .         .         .         .           g.36894
gagagagactgaaactcacctccagccaaagttagcggggcaactgcttgggagggcttc  c.1088-1261

.         .         .         .         .         .           g.36954
tgagtctcctggcccatggcagcagagccatgagcaacactttcccagccagggaaccaa  c.1088-1201

.         .         .         .         .         .           g.37014
aacctgttaccaaaacctcaggggtttggtctaggtcccgctgctcgctgcacagaaagc  c.1088-1141

.         .         .         .         .         .           g.37074
cagtcactgagatgatgagtattgccaagaaggctttaatagggtgctgcagtggaagag  c.1088-1081

.         .         .         .         .         .           g.37134
atgggagctcagtctcaactgtatctccctgaccaactaaaactaagggtttatatagga  c.1088-1021

.         .         .         .         .         .           g.37194
ggcaagaaatgtaacaatgtgtaagaaagtaggagctagaatggggcaaggaaacaatca  c.1088-961

.         .         .         .         .         .           g.37254
agatgaatgaggggtcccacatcccatcatggtctggatgtagtgatctggtgagtttca  c.1088-901

.         .         .         .         .         .           g.37314
gttctttgctactttttttgagatgcttgcaggtctttcctgaggaagtaactcagataa  c.1088-841

.         .         .         .         .         .           g.37374
aacaaatgttaagtttccagtcgttaaggaccagaagggtcaatttctgtttatcaaaaa  c.1088-781

.         .         .         .         .         .           g.37434
aacctttctatgggacaattgggtcagtttcagtttttgtatactcattgcatattaaat  c.1088-721

.         .         .         .         .         .           g.37494
tatattttacacatattcagtaccacacattaaaatgaatgtcacttttttctttttatg  c.1088-661

.         .         .         .         .         .           g.37554
ttctttaaatgaggctgttagaaaacatagcttggtactcctggccccttctatccctgt  c.1088-601

.         .         .         .         .         .           g.37614
ggatggtggtgtgcagtgctttgcacacacatctcatttcattcaatccctggtagtcct  c.1088-541

.         .         .         .         .         .           g.37674
gagatctgggcaggtttgctctgtcttcaggtttgcttcttggtcagggcctgcttgccc  c.1088-481

.         .         .         .         .         .           g.37734
ccacctagctctgccccagcctcagggagggcagaggtcccctgccccagaccctgcact  c.1088-421

.         .         .         .         .         .           g.37794
ttccacagatgcagaagtggccaccctgggacatgctcccatgacaagcgcagcccaggc  c.1088-361

.         .         .         .         .         .           g.37854
agcccgcatcctctgagctcccgctgcagccactctccctccctccctcgggctctcacc  c.1088-301

.         .         .         .         .         .           g.37914
cactttgctttctgcctccgtagggtcaatccatcctccccaggtgggttctcagccctc  c.1088-241

.         .         .         .         .         .           g.37974
tctgagggcagattctctggtgaccttgacgcccgtcagcgccttgggggccacagaggc  c.1088-181

.         .         .         .         .         .           g.38034
caggcagtgtgggtgggctctctgtggatgggaggtgggtgggcaatggagcaacaggtt  c.1088-121

.         .         .         .         .         .           g.38094
tgcccatgcagggggctctccaggttctctccttgggttctgggcctgatgtgggatcct  c.1088-61

.         .         .         .         .         .           g.38154
ctgccccttctgaactgagtcccaactcatctggctgtctctgtggctttctccacccag  c.1088-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center