tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - coding DNA reference sequence

(used for mutation description)

(last modified February 29, 2012)


This file was created to facilitate the description of sequence variants in the TNFRSF10B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012145.1, covering TNFRSF10B transcript NM_003842.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5053
        acttggacgcgcttgcggaggattgcgttgacgagactcttatttattgtcac       c.-241

 .         .         .         .         .         .                g.5113
 caacctgtggtggaatttgcagttgcacattggatctgattcgccccgccccgaatgacg       c.-181

 .         .         .         .         .         .                g.5173
 cctgcccggaggcagtgaaagtacagccgcgccgccccaagtcagcctggacacataaat       c.-121

 .         .         .         .         .         .                g.5233
 cagcacgcggccggagaaccccgcaatctctgcgcccacaaaatacaccgacgatgcccg       c.-61

 .         .         .         .         .         .                g.5293
 atctactttaagggctgaaacccacgggcctgagagactataagagcgttccctaccgcc       c.-1

          .         .         .         .         .         .       g.5353
 ATGGAACAACGGGGACAGAACGCCCCGGCCGCTTCGGGGGCCCGGAAAAGGCACGGCCCA       c.60
 M  E  Q  R  G  Q  N  A  P  A  A  S  G  A  R  K  R  H  G  P         p.20

          .         .         .         .         .         .       g.5413
 GGACCCAGGGAGGCGCGGGGAGCCAGGCCTGGGCCCCGGGTCCCCAAGACCCTTGTGCTC       c.120
 G  P  R  E  A  R  G  A  R  P  G  P  R  V  P  K  T  L  V  L         p.40

          .         .     | 02   .         .         .         .    g.30980
 GTTGTCGCCGCGGTCCTGCTGTTG | GTCTCAGCTGAGTCTGCTCTGATCACCCAACAAGAC    c.180
 V  V  A  A  V  L  L  L   | V  S  A  E  S  A  L  I  T  Q  Q  D      p.60

          .         .         .         .         .         .       g.31040
 CTAGCTCCCCAGCAGAGAGCGGCCCCACAACAAAAGAGGTCCAGCCCCTCAGAGGGATTG       c.240
 L  A  P  Q  Q  R  A  A  P  Q  Q  K  R  S  S  P  S  E  G  L         p.80

          . | 03       .         .         .         .         .    g.43365
 TGTCCACCTG | GACACCATATCTCAGAAGACGGTAGAGATTGCATCTCCTGCAAATATGGA    c.300
 C  P  P  G |   H  H  I  S  E  D  G  R  D  C  I  S  C  K  Y  G      p.100

          .         .         .         .         .         .       g.43425
 CAGGACTATAGCACTCACTGGAATGACCTCCTTTTCTGCTTGCGCTGCACCAGGTGTGAT       c.360
 Q  D  Y  S  T  H  W  N  D  L  L  F  C  L  R  C  T  R  C  D         p.120

      | 04   .         .         .         .         .         .    g.44522
 TCAG | GTGAAGTGGAGCTAAGTCCCTGCACCACGACCAGAAACACAGTGTGTCAGTGCGAA    c.420
 S  G |   E  V  E  L  S  P  C  T  T  T  R  N  T  V  C  Q  C  E      p.140

          .         .         .         .         .       | 05 .    g.45589
 GAAGGCACCTTCCGGGAAGAAGATTCTCCTGAGATGTGCCGGAAGTGCCGCACAGG | GTGT    c.480
 E  G  T  F  R  E  E  D  S  P  E  M  C  R  K  C  R  T  G  |  C      p.160

          .         .         .         .         .         .       g.45649
 CCCAGAGGGATGGTCAAGGTCGGTGATTGTACACCCTGGAGTGACATCGAATGTGTCCAC       c.540
 P  R  G  M  V  K  V  G  D  C  T  P  W  S  D  I  E  C  V  H         p.180

          .         .         .         .         .         .       g.45709
 AAAGAATCAGGTACAAAGCACAGTGGGGAAGTCCCAGCTGTGGAGGAGACGGTGACCTCC       c.600
 K  E  S  G  T  K  H  S  G  E  V  P  A  V  E  E  T  V  T  S         p.200

          .         .         .         .         .         .       g.45769
 AGCCCAGGGACTCCTGCCTCTCCCTGTTCTCTCTCAGGCATCATCATAGGAGTCACAGTT       c.660
 S  P  G  T  P  A  S  P  C  S  L  S  G  I  I  I  G  V  T  V         p.220

          .         .         .         .         .         .       g.45829
 GCAGCCGTAGTCTTGATTGTGGCTGTGTTTGTTTGCAAGTCTTTACTGTGGAAGAAAGTC       c.720
 A  A  V  V  L  I  V  A  V  F  V  C  K  S  L  L  W  K  K  V         p.240

          .         .         | 06         .         .         .    g.46466
 CTTCCTTACCTGAAAGGCATCTGCTCAG | GTGGTGGTGGGGACCCTGAGCGTGTGGACAGA    c.780
 L  P  Y  L  K  G  I  C  S  G |   G  G  G  D  P  E  R  V  D  R      p.260

  | 07       .         .         .         .         .         .    g.46959
  | AGCTCACAACGACCTGGGGCTGAGGACAATGTCCTCAATGAGATCGTGAGTATCTTGCAG    c.840
  | S  S  Q  R  P  G  A  E  D  N  V  L  N  E  I  V  S  I  L  Q      p.280

          .         .         .         .         .         .       g.47019
 CCCACCCAGGTCCCTGAGCAGGAAATGGAAGTCCAGGAGCCAGCAGAGCCAACAGGTGTC       c.900
 P  T  Q  V  P  E  Q  E  M  E  V  Q  E  P  A  E  P  T  G  V         p.300

          .         .         .       | 08 .         .         .    g.49951
 AACATGTTGTCCCCCGGGGAGTCAGAGCATCTGCTG | GAACCGGCAGAAGCTGAAAGGTCT    c.960
 N  M  L  S  P  G  E  S  E  H  L  L   | E  P  A  E  A  E  R  S      p.320

          .         .         .         .          | 09        .    g.51214
 CAGAGGAGGAGGCTGCTGGTTCCAGCAAATGAAGGTGATCCCACTGAGA | CTCTGAGACAG    c.1020
 Q  R  R  R  L  L  V  P  A  N  E  G  D  P  T  E  T |   L  R  Q      p.340

          .         .         .         .         .         .       g.51274
 TGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCATGAGGAAG       c.1080
 C  F  D  D  F  A  D  L  V  P  F  D  S  W  E  P  L  M  R  K         p.360

          .         .         .         .         .         .       g.51334
 TTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGGCCACAGGGAC       c.1140
 L  G  L  M  D  N  E  I  K  V  A  K  A  E  A  A  G  H  R  D         p.380

          .         .         .         .         .         .       g.51394
 ACCTTGTACACGATGCTGATAAAGTGGGTCAACAAAACCGGGCGAGATGCCTCTGTCCAC       c.1200
 T  L  Y  T  M  L  I  K  W  V  N  K  T  G  R  D  A  S  V  H         p.400

          .         .         .         .         .         .       g.51454
 ACCCTGCTGGATGCCTTGGAGACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGAC       c.1260
 T  L  L  D  A  L  E  T  L  G  E  R  L  A  K  Q  K  I  E  D         p.420

          .         .         .         .         .         .       g.51514
 CACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCC       c.1320
 H  L  L  S  S  G  K  F  M  Y  L  E  G  N  A  D  S  A  M  S         p.440

                                                                    g.51517
 TAA                                                                c.1323
 X                                                                  p.440

          .         .         .         .         .         .       g.51577
 gtgtgattctcttcaggaagtcagaccttccctggtttaccttttttctggaaaaagccc       c.*60

          .         .         .         .         .         .       g.51637
 aactggactccagtcagtaggaaagtgccacaattgtcacatgaccggtactggaagaaa       c.*120

          .         .         .         .         .         .       g.51697
 ctctcccatccaacatcacccagtggatggaacatcctgtaacttttcactgcacttggc       c.*180

          .         .         .         .         .         .       g.51757
 attatttttataagctgaatgtgataataaggacactatggaaatgtctggatcattccg       c.*240

          .         .         .         .         .         .       g.51817
 tttgtgcgtactttgagatttggtttgggatgtcattgttttcacagcacttttttatcc       c.*300

          .         .         .         .         .         .       g.51877
 taatgtaaatgctttatttatttatttgggctacattgtaagatccatctacacagtcgt       c.*360

          .         .         .         .         .         .       g.51937
 tgtccgacttcacttgatactatatgatatgaaccttttttgggtggggggtgcggggca       c.*420

          .         .         .         .         .         .       g.51997
 gttcactctgtctcccaggctggagtgcaatggtgcaatcttggctcactatagccttga       c.*480

          .         .         .         .         .         .       g.52057
 cctctcaggctcaagcgattctcccacctcagccatccaaatagctgggaccacaggtgt       c.*540

          .         .         .         .         .         .       g.52117
 gcaccaccacgcccggctaattttttgtattttgtctagatataggggctctctatgttg       c.*600

          .         .         .         .         .         .       g.52177
 ctcagggtggtctcgaattcctggactcaagcagtctgcccacctcagactcccaaagcg       c.*660

          .         .         .         .         .         .       g.52237
 gtggaattagaggcgtgagcccccatgcttggccttacctttctacttttataattctgt       c.*720

          .         .         .         .         .         .       g.52297
 atgttattattttatgaacatgaagaaactttagtaaatgtacttgtttacatagttatg       c.*780

          .         .         .         .         .         .       g.52357
 tgaatagattagataaacataaaaggaggagacatacaatgggggaagaagaagaagtcc       c.*840

          .         .         .         .         .         .       g.52417
 cctgtaagatgtcactgtctgggttccagccctccctcagatgtactttggcttcaatga       c.*900

          .         .         .         .         .         .       g.52477
 ttggcaacttctacaggggccagtcttttgaactggacaaccttacaagtatatgagtat       c.*960

          .         .         .         .         .         .       g.52537
 tatttataggtagttgtttacatatgagtcgggaccaaagagaactggatccacgtgaag       c.*1020

          .         .         .         .         .         .       g.52597
 tcctgtgtgtggctggtccctacctgggcagtctcatttgcacccatagcccccatctat       c.*1080

          .         .         .         .         .         .       g.52657
 ggacaggctgggacagaggcagatgggttagatcacacataacaatagggtctatgtcat       c.*1140

          .         .         .         .         .         .       g.52717
 atcccaagtgaacttgagccctgtttgggctcaggagatagaagacaaaatctgtctccc       c.*1200

          .         .         .         .         .         .       g.52777
 acgtctgccatggcatcaagggggaagagtagatggtgcttgagaatggtgtgaaatggt       c.*1260

          .         .         .         .         .         .       g.52837
 tgccatctcaggagtagatggcccggctcacttctggttatctgtcaccctgagcccatg       c.*1320

          .         .         .         .         .         .       g.52897
 agctgccttttagggtacagattgcctacttgaggaccttggccgctctgtaagcatctg       c.*1380

          .         .         .         .         .         .       g.52957
 actcatctcagaaatgtcaattcttaaacactgtggcaacaggacctagaatggctgacg       c.*1440

          .         .         .         .         .         .       g.53017
 cattaaggttttcttcttgtgtcctgttctattattgttttaagacctcagtaaccattt       c.*1500

          .         .         .         .         .         .       g.53077
 cagcctctttccagcaaacccttctccatagtatttcagtcatggaaggatcatttatgc       c.*1560

          .         .         .         .         .         .       g.53137
 aggtagtcattccaggagtttttggtcttttctgtctcaaggcattgtgtgttttgttcc       c.*1620

          .         .         .         .         .         .       g.53197
 gggactggtttgggtgggacaaagttagaattgcctgaagatcacacattcagactgttg       c.*1680

          .         .         .         .         .         .       g.53257
 tgtctgtggagttttaggagtggggggtgacctttctggtctttgcacttccatcctctc       c.*1740

          .         .         .         .         .         .       g.53317
 ccacttccatctggcatcccacgcgttgtcccctgcacttctggaaggcacagggtgctg       c.*1800

          .         .         .         .         .         .       g.53377
 ctgcctcctggtctttgcctttgctgggccttctgtgcaggacgctcagcctcagggctc       c.*1860

          .         .         .         .         .         .       g.53437
 agaaggtgccagtccggtcccaggtcccttgtcccttccacagaggccttcctagaagat       c.*1920

          .         .         .         .         .         .       g.53497
 gcatctagagtgtcagccttatcagtgtttaagatttttcttttatttttaatttttttg       c.*1980

          .         .         .         .         .         .       g.53557
 agacagaatctcactctctcgcccaggctggagtgcaacggtacgatcttggctcagtgc       c.*2040

          .         .         .         .         .         .       g.53617
 aacctccgcctcctgggttcaagcgattctcgtgcctcagcctccggagtagctgggatt       c.*2100

          .         .         .         .         .         .       g.53677
 gcaggcacccgccaccacgcctggctaatttttgtatttttagtagagacggggtttcac       c.*2160

          .         .         .         .         .         .       g.53737
 catgttggtcaggctggtctcgaactcctgacctcaggtgatccaccttggcctccgaaa       c.*2220

          .         .         .         .         .         .       g.53797
 gtgctgggattacaggcgtgagccaccagccaggccaagctattcttttaaagtaagctt       c.*2280

          .         .         .         .         .         .       g.53857
 cctgacgacatgaaataattgggggttttgttgtttagttacattaggctttgctatatc       c.*2340

          .         .         .         .         .         .       g.53917
 cccaggccaaatagcatgtgacacaggacagccatagtatagtgtgtcactcgtggttgg       c.*2400

          .         .         .         .         .         .       g.53977
 tgtcctttcatgcttctgccctgtcaaaggtccctatttgaaatgtgttataatacaaac       c.*2460

          .         .         .         .         .         .       g.54037
 aaggaagcacattgtgtacaaaatacttatgtatttatgaatccatgaccaaattaaata       c.*2520

          .                                                         g.54055
 tgaaaccttatataaaaa                                                 c.*2538

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor receptor superfamily, member 10b protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center