tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - downstream reference sequence


         .            .         .         .         .         . g.54097
tgaaaccttatataaaaa / gaggtgtggtttttgtctcccgccccccaacctcccctcctc c.*2580

         .         .         .         .         .         .    g.54157
ctgtgaatcagctctgagtgacaggaaaccagggctgtgctcctgctgggactccttcct    c.*2640

         .         .         .         .         .         .    g.54217
tcctccctcccctctgttttcaggcttggcctcctgggggtgtttcctgaatccgactcc    c.*2700

         .         .         .         .         .         .    g.54277
ccagagtttaaagagctaggttcctggggactgggattcatacctccttcccctctctct    c.*2760

         .         .         .         .         .         .    g.54337
cctgcctgctcctccctctggggacagggacaccaatgttggcctggctcacccacagcc    c.*2820

         .         .         .         .         .         .    g.54397
tcccaggagagttctctgggctgccgggttgcatctggttccgacagctctcggggaatg    c.*2880

         .         .         .         .         .         .    g.54457
ggcggtgggtccctgaagttggggggccggccctgtttctcagggaatcccgtggtcact    c.*2940

         .         .         .         .         .         .    g.54517
ctcctatggcttcctacagccctgggtcgaccttcactttctctgccccggccttccctg    c.*3000

         .         .         .         .         .         .    g.54577
catccccaccagggtacccaggttgctcagcgcttcaggcacctaggagacctatttccc    c.*3060

         .         .         .         .         .         .    g.54637
gttccccttgccctggaggacccgctctccctttcgtccacagcttccgggaggcccagg    c.*3120

         .         .         .         .         .         .    g.54697
tgtgcccccacgctgtccatcttccctagaagtggaggtgctccgggttcccccttcgtc    c.*3180

         .         .         .         .         .         .    g.54757
cccccagccctgcccatgggcttctgggcctcacttggagccctgggctgcgctgagctg    c.*3240

         .         .         .         .         .         .    g.54817
cagggaggccgagcagcctgtagagggcagcatacgcgtggctttccagccagccgccct    c.*3300

         .         .         .         .         .         .    g.54877
ggaggccgtggaggggaggcagccacagtcctggaggggcctgggcctggacaacatggc    c.*3360

         .         .         .         .         .         .    g.54937
cgcccccagggttagagccgcttgtcctccagccgcctggtctctcttgatgaggattta    c.*3420

         .         .         .         .         .         .    g.54997
acctctggtcattaggtcctgcctgctacctttgtttcaggttagctcaatcccaggcct    c.*3480

         .         .         .         .         .         .    g.55057
aaccagcgttttcctggagcccaccccagggccaggccctctcagctagaacatctctct    c.*3540

         .         .         .         .         .         .    g.55117
caggtaaggcgactcctgagctctgagcccacagccccactgcctcctggctctgcccct    c.*3600

         .         .         .         .         .         .    g.55177
cctccgtgggactccatcttttacacctaaaaagagtgtgggtggtgaaatctgagtcgg    c.*3660

         .         .         .         .         .         .    g.55237
ggttagaaaacggaaaggggcaattgtggcccagctgctgccccatgggggctgggagct    c.*3720

         .         .         .         .         .         .    g.55297
agtttcaatcccccacattcctccagccccgccctcctcctctctagaccaactctgctt    c.*3780

         .         .         .         .         .         .    g.55357
ttcctcctgctccattctccctcttctccttccccttatcccaccccagcagtaataagg    c.*3840

         .         .         .         .         .         .    g.55417
ctgtgtcctgtggcctttcactacaggtcagtgcccctttccctgacttttggcccctat    c.*3900

         .         .         .         .         .         .    g.55477
tgcagccccgcaaaaacacccaccataagcactctctgagggtaaggaagggagcctgca    c.*3960

         .         .         .         .         .         .    g.55537
gtctccagatgggcaaaagcaagagtctggtgccatttaagccccgagaccaaacccctc    c.*4020

         .         .         .         .         .         .    g.55597
tttgccgccagcccgggcccctcaatcaccagccctctagaggccaggcccctgtgttgc    c.*4080

         .         .         .         .         .         .    g.55657
cctcggagccagctggcagggtcagggcctccgcagtcagagaagtgccgagtcctttcc    c.*4140

         .         .         .         .         .         .    g.55717
tgaaaggcattggagtcgattctgcaacctaaatcttcacctcctcatcatgggggcctc    c.*4200

         .         .         .         .         .         .    g.55777
tgtttatagaaatgtgagctaggcaggggctttttctgattttcattctttggagggata    c.*4260

         .         .         .         .         .         .    g.55837
gaggacagagtgtttgttgatttttcgtttcggtttcagtttggttgtcattggtttttg    c.*4320

         .         .         .         .         .         .    g.55897
ttttttgctaattttgccccaccctataaaaagcagtgccacccagaggcaggggagggc    c.*4380

         .         .         .         .         .         .    g.55957
cctgaggagcacggggtcgccgtgcactcattcctacttccttctccacctgtcccagct    c.*4440

         .         .         .         .         .         .    g.56017
gcttcctttggttaccatctccaaatctgagggtaaaggagggggtgagggagaagtttc    c.*4500

         .         .         .                                  g.56055
ttgttgcaccaagaggcactgcttccaggcctggagct                          c.*4538


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center