tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - 1037 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.43489
gtacagaacatatggaccccatgcctaaaggtggaatgcggggtgatgacataaaagttg  c.364+60

         .         .         .         .         .         .  g.43549
tagctaaaatgggatcaggagacctagattctggtccaccttggtcttcatcataccatg  c.364+120

         .         .         .         .         .         .  g.43609
ttccatgattttgtctttgagctttttaataaataaaacaggcccggcacagtggctcat  c.364+180

         .         .         .         .         .         .  g.43669
gcctgtaatctcaacactttgggaggcatcacttgagcccaggagtttgaaaccatcctg  c.364+240

         .         .         .         .         .         .  g.43729
ggcaacatgagaaaccccgtctctacaaaaatataaacattagccgggcatggtggcgcg  c.364+300

         .         .         .         .         .         .  g.43789
tgcctgtatttccagctacttaggaagctgaggcagaaggatctcttgagcccaggaggc  c.364+360

         .         .         .         .         .         .  g.43849
cgaggttgcagggagccgagattgtgccactgcattccagcccaggcaacagagcaaaac  c.364+420

         .         .         .         .         .         .  g.43909
cctgtctcaataattaattaaaataataataatacagaaattatttgtataatgtatgct  c.364+480

         .         .         .           g.43948
acatggtaaggaaatcttttaaactgtcagctgcaaggg  c.364+519

--------------------- middle of intron ---------------------
           g.43949            .         .         .           g.43986
           c.365-518  ggtggggccatgagccaggccaagtggacagggctgga  c.365-481

.         .         .         .         .         .           g.44046
tctcagcagtggcacaggtctgctttggggccaggctctctcccctgggctctgtgctcc  c.365-421

.         .         .         .         .         .           g.44106
tggcaggtgctcggcctcactcacccttcaggttctcaggcctctccctcctccccagca  c.365-361

.         .         .         .         .         .           g.44166
ggctgggccttggggaagtcccccaagggctcctctccttgcagtctctcaggtgatccc  c.365-301

.         .         .         .         .         .           g.44226
ttgcacttcccttgctactggccatgcaatctaaacgatgcttgtcccctaaacggtgct  c.365-241

.         .         .         .         .         .           g.44286
ttcccctaatctaatgtaataaataatgaactgtggtccttttgtatgactcaacgagtg  c.365-181

.         .         .         .         .         .           g.44346
ttagtgacagctgaagggtgggtatcctgaatgagccatgagtgtgctggtgcagaaact  c.365-121

.         .         .         .         .         .           g.44406
ggccctcagaactccttggcaaactgagttgagctgagtagcagggtcttggggtgggga  c.365-61

.         .         .         .         .         .           g.44466
ggaagggtcaagggacacatcaggaaaacacattcccaaaaccttatgctctgtcgtcag  c.365-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center