tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - 1007 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.44638
gtgagacaggagccgggggctcccagtagctccatggaaccccaaaagacccaagtctcc  c.476+60

         .         .         .         .         .         .  g.44698
ttgtacccctgtctctcccctgacagcacccgcaaggggcatccttgaggctgtggctgc  c.476+120

         .         .         .         .         .         .  g.44758
ccctcctggtccctctgcgtgtcaccacccctgccccctgcagcagcctctttccacccc  c.476+180

         .         .         .         .         .         .  g.44818
tccccagcacgagtccccttgaccaggctgacttgttcactgaccacagaaggccatgac  c.476+240

         .         .         .         .         .         .  g.44878
ttggggcccatgataattttaggggcccatgaaatgatttaatttctcttgaaataagaa  c.476+300

         .         .         .         .         .         .  g.44938
gaatgagtagaatgcagccaggcatatattcatctttataccaattcagcaataaaatgt  c.476+360

         .         .         .         .         .         .  g.44998
attttttaatatttttatgcatgcaggggcccataaagacaaaagtgcccatggcccaca  c.476+420

         .         .         .         .         .         .  g.45058
aaaggcataataaggccatgggtggagctccttcaagttcccatgaggacctgagcccac  c.476+480

         .         .      g.45082
ccagccggcctcacccctggcccc  c.476+504

--------------------- middle of intron ---------------------
                          g.45083       .         .           g.45105
                          c.477-503  tgatccctcagtaagacctgtct  c.477-481

.         .         .         .         .         .           g.45165
tttccctatttgggttttaggggccaagagtaatttgctcttctctggcccccctagtat  c.477-421

.         .         .         .         .         .           g.45225
ttgctgtgattgggggaaatgggcagacagctggggacaagagctcacttttgtggttga  c.477-361

.         .         .         .         .         .           g.45285
ctggaagaccggactcatcttgtggccacacgggcttgtgaccttcccctggagtgtgat  c.477-301

.         .         .         .         .         .           g.45345
tgctcctaacgcaggcctcccctgcagcccagggaagctcagtgtgtgcccagcacagaa  c.477-241

.         .         .         .         .         .           g.45405
ggctcctggaactgcagctctgaccccagagcagggaggccgaggggctgaagtgcgcat  c.477-181

.         .         .         .         .         .           g.45465
gctcagacccttccccagcctcaagaagggagcacagggggacccactgctgacacgagg  c.477-121

.         .         .         .         .         .           g.45525
agactgtccttcccctgacaccttctcagggacactggggagggagggtggctcctcttt  c.477-61

.         .         .         .         .         .           g.45585
catcccacctggccagctttccatcaagagtcccccctctccctctgtgtgtgtacccag  c.477-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center