tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - 577 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.45917
gtaggtgctggctgagggcgggggcacagggcactctctgccctgccccctcccacccta  c.748+60

         .         .         .         .         .         .  g.45977
ttcccacagacagaaacgcctgcccctgccccaagtctaagtgcctccagcctggctcta  c.748+120

         .         .         .         .         .         .  g.46037
tcctcctcctcgtggtcacccccatccccacatcccgtgcaccccccaggaccctggtct  c.748+180

         .         .         .         .         .         .  g.46097
cttcagtccctctcccaggtctgggggtccccatatctcccagccaagtccaggagggca  c.748+240

         .         .         .         .           g.46146
gggccagttcctcccatcttcaggcccagccaggcagggggcagtcggc  c.748+289

--------------------- middle of intron ---------------------
 g.46147            .         .         .         .           g.46194
 c.749-288  tcctcaactgggtgacaagggtgaggatgagaagtggtcgtgggattt  c.749-241

.         .         .         .         .         .           g.46254
tttcagccttggtcagagcagaaccagagattttccaagtgtttgtttttactctagttc  c.749-181

.         .         .         .         .         .           g.46314
cccttctcatcccccttcctcagggtgtctctgagttgtaaggccccattctgtccccag  c.749-121

.         .         .         .         .         .           g.46374
ccccagggctccttgtccagtgtcccagcccccagcccagccctgcgccccactgtcctc  c.749-61

.         .         .         .         .         .           g.46434
tgggaggggggtgcttcatgggcccctcccttcctgctaaggagactgcttcttttttag  c.749-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center