tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - 433 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.46526
gtgagttgatttctccaggagctgggggctcaggggttcaggaactgcttcctgggacag  c.780+60

         .         .         .         .         .         .  g.46586
cagaacctgggtgggtgggtccccattgtcctcatggctgccctgactctctgaagtggc  c.780+120

         .         .         .         .         .         .  g.46646
ctgggtgctctgggctgactgtgggggacacatggccattttgagcaccacataggctgg  c.780+180

         .         .         .         g.46683
tgagccctgctgcagcccaggtgacatcctcacccca  c.780+217

--------------------- middle of intron ---------------------
             g.46684          .         .         .           g.46719
             c.781-216  cagcctgcaccctagggatggggtgtctgcctgagc  c.781-181

.         .         .         .         .         .           g.46779
acagcactgggggcctggccccagcagcgggtcctggatgtgctgagtctgggctgcctg  c.781-121

.         .         .         .         .         .           g.46839
cggtgacctcactgagagggggtggggatgtcaggtgcagctgcatactgaggaccctgc  c.781-61

.         .         .         .         .         .           g.46899
agcgagccctaggtgtggactcctgagtcggctttttgccttcccaatgtctttttccag  c.781-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center