tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B) - 1203 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.50060
gtaagtgttttgctcctggagatgcagcaggaatggagggaatagggacagggtcctaac  c.1009+60

         .         .         .         .         .         .  g.50120
tgctgtccccagaggtcagagggctcttccagagtattccatgctggaagccgtgggtcc  c.1009+120

         .         .         .         .         .         .  g.50180
tgtgctatagaccatctggaccctaaactgtcttctcccatctcttctccccactctacc  c.1009+180

         .         .         .         .         .         .  g.50240
tcatcctctctgcaccctatcattgaccctaatgactctgtccgtcccctcatcctctct  c.1009+240

         .         .         .         .         .         .  g.50300
cctcctttgttcagggcctgatgtagcccccgcctgcccctgaggacctcctgaggggct  c.1009+300

         .         .         .         .         .         .  g.50360
ggcctgtcctgcacagcaccactaaccccagtgggctaaggagctcttgacctgtgcctc  c.1009+360

         .         .         .         .         .         .  g.50420
agcccaatttgcagagctgttgtgtaaactacatacgaatgccaaagacttaatgcaaaa  c.1009+420

         .         .         .         .         .         .  g.50480
aagagtggaaaatatttcactcataatttttgtatattgattgtatattaaattatattt  c.1009+480

         .         .         .         .         .         .  g.50540
taaatatattcagtaccatacattaaaatgaatgtcacttgtttctgatgttctttaaaa  c.1009+540

         .         .         .         .         .         .  g.50600
taaggctgttggaaaacatagcctcgtgttcctgaccctgtctatctctgaggacggcga  c.1009+600

    g.50602
gg  c.1009+602

--------------------- middle of intron ---------------------
                                               g.50603        g.50603
                                               c.1010-601  t  c.1010-601

.         .         .         .         .         .           g.50663
gcatcatgttgcacacacgtctcatttaatccctcatcgtcccgagatctgggcagcatt  c.1010-541

.         .         .         .         .         .           g.50723
gctcggtctttgggttcacttcttgctcagagtctgtttgcctccacctagctctgcccc  c.1010-481

.         .         .         .         .         .           g.50783
agccccaggaagtgaggccgagctgggtgaaaacagaggtcccctgtcccaggccctgtg  c.1010-421

.         .         .         .         .         .           g.50843
ctttccacagatgcagaagtggccgccctgggacctgctcccatgacaagcgcagcccag  c.1010-361

.         .         .         .         .         .           g.50903
gcagcctcctccctcctctaagctcccgctgcagccactgtctctccctccctcggactc  c.1010-301

.         .         .         .         .         .           g.50963
tcacgcactttactttctgcctctgtaacgtccatccatactcccctggtgggttctcag  c.1010-241

.         .         .         .         .         .           g.51023
ccctgtatgagggctgattctctgacgactttgactccccgcagtgccttgcgtgtgggg  c.1010-181

.         .         .         .         .         .           g.51083
gaggccaggcagtgtgggcgcgctctctgtggatgggaagcgggtgggcactggagcggc  c.1010-121

.         .         .         .         .         .           g.51143
aggtttgcccgcacacggggctctccaggttccccgccttgggttctgggcctgatgtgg  c.1010-61

.         .         .         .         .         .           g.51203
aatcctctgccctttctgagtcccaactcacctggctgtctctgtggctttctccaccag  c.1010-1


Powered by LOVD v.2.0 Build 33
©2004-2012 Leiden University Medical Center