tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - coding DNA reference sequence

(used for mutation description)

(last modified May 2, 2012)


This file was created to facilitate the description of sequence variants in the TNFRSF10C gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032578.1, covering TNFRSF10C transcript NM_003841.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5008
                                                     gaggccat       c.-301

 .         .         .         .         .         .                g.5068
 gccccttttctgagtgcttggaagtgactgctgcaagtgacaagtgaccacgccttttcc       c.-241

 .         .         .         .         .         .                g.5128
 cccgcgggtataaattcagaggcgctgcgctccgattctggcagtgcagctgtgggaacc       c.-181

 .         .         .         .         .         .                g.5188
 tctccacgcgcacgaactcagccaacgatttctgatagatttttgggagtttgaccagag       c.-121

 .         .         .         .         .         .                g.5248
 atgcaaggggtgaaggagcgcttcctaccgttagggaactctggggacagagcgccccgg       c.-61

 .         .         .         .         .         .                g.5308
 ccgcctgatggccgaggcagggtgcgacccaggacccaggacggcgtcgggaaccatacc       c.-1

          .         .         .         .         .         .       g.5368
 ATGGCCCGGATCCCCAAGACCCTAAAGTTCGTCGTCGTCATCGTCGCGGTCCTGCTGCCA       c.60
 M  A  R  I  P  K  T  L  K  F  V  V  V  I  V  A  V  L  L  P         p.20

  | 02       .         .         .         .         .         .    g.13966
  | GTCCTAGCTTACTCTGCCACCACTGCCCGGCAGGAGGAAGTTCCCCAGCAGACAGTGGCC    c.120
  | V  L  A  Y  S  A  T  T  A  R  Q  E  E  V  P  Q  Q  T  V  A      p.40

          .         .         .         .       | 03 .         .    g.16857
 CCACAGCAACAGAGGCACAGCTTCAAGGGGGAGGAGTGTCCAGCAG | GATCTCATAGATCA    c.180
 P  Q  Q  Q  R  H  S  F  K  G  E  E  C  P  A  G |   S  H  R  S      p.60

          .         .         .         .         .         .       g.16917
 GAACATACTGGAGCCTGTAACCCGTGCACAGAGGGTGTGGATTACACCAACGCTTCCAAC       c.240
 E  H  T  G  A  C  N  P  C  T  E  G  V  D  Y  T  N  A  S  N         p.80

          .         .         .         . | 04       .         .    g.17714
 AATGAACCTTCTTGCTTCCCATGTACAGTTTGTAAATCAG | ATCAAAAACATAAAAGTTCC    c.300
 N  E  P  S  C  F  P  C  T  V  C  K  S  D |   Q  K  H  K  S  S      p.100

          .         .         .         .         .         .       g.17774
 TGCACCATGACCAGAGACACAGTGTGTCAGTGTAAAGAAGGCACCTTCCGGAATGAAAAC       c.360
 C  T  M  T  R  D  T  V  C  Q  C  K  E  G  T  F  R  N  E  N         p.120

          .         .          | 05        .         .         .    g.18858
 TCCCCAGAGATGTGCCGGAAGTGTAGCAG | GTGCCCTAGTGGGGAAGTCCAAGTCAGTAAT    c.420
 S  P  E  M  C  R  K  C  S  R  |  C  P  S  G  E  V  Q  V  S  N      p.140

          .         .         .         .         .         .       g.18918
 TGTACGTCCTGGGATGATATCCAGTGTGTTGAAGAATTTGGTGCCAATGCCACTGTGGAA       c.480
 C  T  S  W  D  D  I  Q  C  V  E  E  F  G  A  N  A  T  V  E         p.160

          .         .         .         .         .         .       g.18978
 ACCCCAGCTGCTGAAGAGACAATGAACACCAGCCCGGGGACTCCTGCCCCAGCTGCTGAA       c.540
 T  P  A  A  E  E  T  M  N  T  S  P  G  T  P  A  P  A  A  E         p.180

          .         .         .         .         .         .       g.19038
 GAGACAATGAACACCAGCCCAGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGACCACC       c.600
 E  T  M  N  T  S  P  G  T  P  A  P  A  A  E  E  T  M  T  T         p.200

          .         .         .         .         .         .       g.19098
 AGCCCGGGGACTCCTGCCCCAGCTGCTGAAGAGACAATGACCACCAGCCCGGGGACTCCT       c.660
 S  P  G  T  P  A  P  A  A  E  E  T  M  T  T  S  P  G  T  P         p.220

          .         .         .         .         .         .       g.19158
 GCCCCAGCTGCTGAAGAGACAATGACCACCAGCCCGGGGACTCCTGCCTCTTCTCATTAC       c.720
 A  P  A  A  E  E  T  M  T  T  S  P  G  T  P  A  S  S  H  Y         p.240

          .         .         .         .         .         .       g.19218
 CTCTCATGCACCATCGTAGGGATCATAGTTCTAATTGTGCTTCTGATTGTGTTTGTTTGA       c.780
 L  S  C  T  I  V  G  I  I  V  L  I  V  L  L  I  V  F  V  X         p.259

          .         .         .         .         .         .       g.19278
 aagacttcactgtggaagaaattccttccttacctgaaaggttcaggtaggcgctggctg       c.*60

          .         .         .         .         .         .       g.19338
 agggcggggggcgctggacactctctgccctgcctccctctgctgtgttcccacagacag       c.*120

          .         .         .         .         .         .       g.19398
 aaacgcctgcccctgccccaagtcctggtgtctccagcctggctctatcttcctccttgt       c.*180

          .         .         .         .         .         .       g.19458
 gatcgtcccatccccacatcccgtgcaccccccaggaccctggtctcatcagtccctctc       c.*240

          .         .         .         .         .         .       g.19518
 ctggagctgggggtccacacatctcccagccaagtccaagagggcagggccagttcctcc       c.*300

          .         .         .         .         .         .       g.19578
 catcttcaggcccagccaggcagggggcagtcggctcctcaactgggtgacaagggtgag       c.*360

          .         .         .         .                           g.19624
 gatgagaagtggtcacgggatttattcagccttggtcagagcagaa                     c.*406

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center