tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - downstream reference sequence


         .         .         .         .            .         . g.19638
gatgagaagtggtcacgggatttattcagccttggtcagagcagaa / cacagagattttcc c.*420

         .         .         .         .         .         .    g.19698
gtgtgttggtttttactctagttccccttctcatcccccttcctcagggtgtcccctaat    c.*480

         .         .         .         .         .         .    g.19758
tgcaaggccccattcctgtccccagccccagggctccttgtccagtgtcccagcccccag    c.*540

         .         .         .         .         .         .    g.19818
cccagccctgtgccccactgtcctctgggagggaggtgctgcatgggcccctccccacct    c.*600

         .         .         .         .         .         .    g.19878
gctaaggagactcgttctcttccaagtggtgaaagggcccctgagcgtgtagacagagtg    c.*660

         .         .         .         .         .         .    g.19938
acttggtttctccagaaactggaagcctcatgggctgaggaactgcctcccacccacagc    c.*720

         .         .         .         .         .         .    g.19998
agagccctggcggacacaatcccttttcctcatggctgccctgactctctgaagtggctt    c.*780

         .         .         .         .         .         .    g.20058
ggggttctgggctgactgtgggggacacatggccatcttgagcatcacacagaccggcgg    c.*840

         .         .         .         .         .         .    g.20118
gtcctgctgcagtcctgtccttcctgtagtcttcactccacagcctcactccacagtgag    c.*900

         .         .         .         .         .         .    g.20178
tgaccctcactggacaccctcactccacagcctgcaacctgaggatggggtgtccgcctg    c.*960

         .         .         .         .         .         .    g.20238
agcacagcatcgggggcctggccccagcagcgggtcctggatgtgctgagattgggctgc    c.*1020

         .         .         .         .         .         .    g.20298
ctgggttgacctcattgggaggaggtggggacggcaggtccagctgcgtactggggaccc    c.*1080

         .         .         .         .         .         .    g.20358
tgctgcaagccctggatgtggactcctgagtcagttctttgccttcctgtggtctttttc    c.*1140

         .         .         .         .         .         .    g.20418
cggcactcacatcgcccaccaaggcctgggtgggtgagaacagtgcccacaaggagaccc    c.*1200

         .         .         .         .         .         .    g.20478
tgagtaacagagactcacagcccatccaggtctctgggcaggaaattgaaggaatcatca    c.*1260

         .         .         .         .         .         .    g.20538
cattttacagaggaggagactgcagctcagagtgggggaagtgtgtgcaccaggccacag    c.*1320

         .         .         .         .         .         .    g.20598
gcaagtctgtccagagcactggtaggaatgagggaaactaggaatgaccactttaaaaag    c.*1380

         .         .         .         .         .         .    g.20658
ttagatgagaagaatttcaaggccgggcgcggtggctcacgcctgtaatcccagcacttt    c.*1440

         .         .         .         .         .         .    g.20718
gggaggcggagatgggcggatcacgaggtcagaagattgagaccatcctggctaacacgg    c.*1500

         .         .         .         .         .         .    g.20778
tgaaaccccgtctctactaaaaatacaaaaaattagccgggcgcggtggcggacgcctgt    c.*1560

         .         .         .         .         .         .    g.20838
agtcccagctactcgggaggctgaggcaggagaatggcgtgaacccgggaggcggagctt    c.*1620

         .         .         .         .         .         .    g.20898
gcagtgagccgcgatcgcgccactgcactccagcctgggggacagagcgagactccatct    c.*1680

         .         .         .         .         .         .    g.20958
caaacaacacacacacacacaaaacaaccaaaaaaagaaagaaagaaagaatttcaaagt    c.*1740

         .         .         .         .         .         .    g.21018
taagtcattggagtttgttggtaatatatttgtatggcttaggtcatgttacgcgcatca    c.*1800

         .         .         .         .         .         .    g.21078
ccccctcaccccatgtctgctgttgggtctcagcactgggtggagggaggggcaatagtc    c.*1860

         .         .         .         .         .         .    g.21138
ctggtgaagaggaggggggagcggcaccagctggagtggggcctctgccgctgcctcttc    c.*1920

         .         .         .         .         .         .    g.21198
ctgctgtggtttctccggcttagactgcccctctcacctggcttgtctgtggggagatct    c.*1980

         .         .         .         .         .         .    g.21258
ttgttctctggctgcttttaagactttctccttaacagtggtttcagcaattcgattgag    c.*2040

         .         .         .         .         .         .    g.21318
gcaaaaaggagctgcagaagccatgtctgtagcatttgtggcctccccttctgtataata    c.*2100

         .         .         .         .         .         .    g.21378
gcagccatgttttggcctctgcagggctaaggtcctctgagcagctgcttctccacatct    c.*2160

         .         .         .         .         .         .    g.21438
ctgccatgcactcggcctcggagctcctggtgttcctcagcagagtccacagggctcttt    c.*2220

         .         .         .         .         .         .    g.21498
ggggtcccctccctgtgctgtagcctggaatctgtgacctgaggcggtgagctgaggcca    c.*2280

         .         .         .         .         .         .    g.21558
ccactgggctcacctcatgggcttggagggaaagtcactcccccaggaagtaggtgatga    c.*2340

         .         .         .         .         .         .    g.21618
gccctttactctgagaatgtctgcgcctggtggtggtgggaggacaaatgagccctgtgt    c.*2400

                                                                g.21624
cagtcc                                                          c.*2406


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center