tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - 2831 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14072
gtgcactcttatttttaaaaatcagtttatttttaattgacagataaacattgtatgtat  c.166+60

         .         .         .         .         .         .  g.14132
ttatgatgtacaccatgatgttttgaaatatgtacgcattgtggaatggctaaatcaagc  c.166+120

         .         .         .         .         .         .  g.14192
taattcacatacttaatcatgtattcgtggtaagaacacttaaaaatctgctcagcaatt  c.166+180

         .         .         .         .         .         .  g.14252
ttcagctgtatggatacagagccctgggataagccctctttgccctttttatctgtgggt  c.166+240

         .         .         .         .         .         .  g.14312
tctgtagccttccttatctatgggttctgtatccatggttgcaacaaaccacagatcaaa  c.166+300

         .         .         .         .         .         .  g.14372
aatatgcggaagaaataaaaatgataatacatcaataaaagcagataaaaagcaatgcag  c.166+360

         .         .         .         .         .         .  g.14432
tatagcacttatttacatagcatgtctattgcattaggtattacaagtaatctagagatg  c.166+420

         .         .         .         .         .         .  g.14492
atttaaagcatatgtgcgtgggttttatgcaatactatcccaatttatatcagggacttg  c.166+480

         .         .         .         .         .         .  g.14552
agtatatgcagagtttgttccatggaatatattccctgtggatagaaggcaggactgtac  c.166+540

         .         .         .         .         .         .  g.14612
aacacattgttttaataactgtagtcgccatgtcacacaatacatctcttgaatttattc  c.166+600

         .         .         .         .         .         .  g.14672
tccctgtctaactgaaattttgtatcctttgactaacatctccccatcccaccatccaac  c.166+660

         .         .         .         .         .         .  g.14732
tcaagccctggtaatcaccattctgctctccacctctatgagaccaactttttctgattc  c.166+720

         .         .         .         .         .         .  g.14792
cacatatgtgagatcatgaggtgtttgcctttctgtgcctggcttatttcacttagcata  c.166+780

         .         .         .         .         .         .  g.14852
gtatcctccagcttcatccatgctgacacaaatgacagaactcccttctttttaaaggct  c.166+840

         .         .         .         .         .         .  g.14912
gaatagtattccattgtatctatgtgtcacattttctttaacttttcatccatccatgga  c.166+900

         .         .         .         .         .         .  g.14972
cacgtaggttgattccatgtcttgaccattgtaaataatgctccaatgcatatgggaggg  c.166+960

         .         .         .         .         .         .  g.15032
aagatatctcttcaatatactgacgtcatttcctttggatgtatacccaatagtgggatt  c.166+1020

         .         .         .         .         .         .  g.15092
gctagatcatatagttgttctattttttgttttttgaggaacctccatactgttttccat  c.166+1080

         .         .         .         .         .         .  g.15152
aatggctgtactaatttccattcccaccaacagtgtaccagcattcctttttctccccat  c.166+1140

         .         .         .         .         .         .  g.15212
catcaacacttgttaccttttgtctttttggtaatagccattcttacaggtgtgaagtga  c.166+1200

         .         .         .         .         .         .  g.15272
tatttggcacttgatggttagtgatgctgagcatttttttcatatactttttggccactt  c.166+1260

         .         .         .         .         .         .  g.15332
ctatgtctccttttgagaagtgtctattcaggtcccacgcccatgtatccattttacttg  c.166+1320

         .         .         .         .         .         .  g.15392
gattatttgattgtgtgctattgagatgtttgagttcctgtgtattttggattttaacca  c.166+1380

         .         .         .        g.15428
aaatcttggatcttttgaatattgaccctcattctg  c.166+1416

--------------------- middle of intron ---------------------
             g.15429          .         .         .           g.15463
             c.167-1415  taggttgtctcttcactctgttcattgtttccttt  c.167-1381

.         .         .         .         .         .           g.15523
gtcatgcagaacctttttagtgtaatgtaacctcatttgtctgtttttccttttgttgcc  c.167-1321

.         .         .         .         .         .           g.15583
tgtgcttttggggtcatagtcaagaaaccattgcccagaccaacatcatgaaaattttcc  c.167-1261

.         .         .         .         .         .           g.15643
cctatgtattcttgtggtagttttaccatttcagatcttatgttttaatctttagtccat  c.167-1201

.         .         .         .         .         .           g.15703
tttgaattaatttttacatatgatgtgagataaaggtcttatttcattcttctgcatgtc  c.167-1141

.         .         .         .         .         .           g.15763
aatacctacttttctcaacaccatttattgaagagctgtcctttccccattttgtgttct  c.167-1081

.         .         .         .         .         .           g.15823
tggtatctttctcacaatcaatcaactgtaaatgcattgatttatacctgggttcactat  c.167-1021

.         .         .         .         .         .           g.15883
tttgttccatcagtttatttaccattgttgtgccattaccattcagttttgattactata  c.167-961

.         .         .         .         .         .           g.15943
cttttgtaacacgttttaaaatcaggtagtacgatgcctccatctttgttcttttgtttg  c.167-901

.         .         .         .         .         .           g.16003
ttttgcttaagatcactttggctatttgaggtcttttgtagttccatacaaatctgggcg  c.167-841

.         .         .         .         .         .           g.16063
tggtggtgcgtcgcctataatcccagctactcgggaggctgaggcagaaaaatcgcttga  c.167-781

.         .         .         .         .         .           g.16123
accagggagttggaggttgcagtgagccgagattgtgccactgcactccagccaggtgac  c.167-721

.         .         .         .         .         .           g.16183
agagcaagactctgtctcaaaaaaaaaaaaaaagacacatgaatatacataacagtcagg  c.167-661

.         .         .         .         .         .           g.16243
atgtcctgatgggaaccatgaagaatagttaagtgacaggagatagacaaggttggtggg  c.167-601

.         .         .         .         .         .           g.16303
gcctctcggggatggtgatttgggctgatatttaaagttggacagggccagtcttgcaga  c.167-541

.         .         .         .         .         .           g.16363
gagccaggaagagtgctcttgagaaggccctgaaggaatgagaaccccaggtttcggggg  c.167-481

.         .         .         .         .         .           g.16423
cttggggagactgagcgaagacagggggccactgtggtgagtggacagcaaacaggtcag  c.167-421

.         .         .         .         .         .           g.16483
gtggaccagcatgggcagatcacatgtacagtaggttggatgttattttgtgagtgacgg  c.167-361

.         .         .         .         .         .           g.16543
cgtaaaaaaagtaaaatatctcaatgatgtgtattgattacatgttgaaatgtagtattt  c.167-301

.         .         .         .         .         .           g.16603
cagatattttaggttaaaactatattgttaaaattaatttggcctcattctttttactat  c.167-241

.         .         .         .         .         .           g.16663
tttaatatggctctcatagaatttgaattttgcatagaatttgaattttgtattatattt  c.167-181

.         .         .         .         .         .           g.16723
ctgtcagcagtgccagtcaaaggtatgtaatagatgctgaatggatgacaagaccaagcc  c.167-121

.         .         .         .         .         .           g.16783
tggaagagtggatttctctgtctcaattccagtgagggccaaaaaagaagtttccccacc  c.167-61

.         .         .         .         .         .           g.16843
actgtcagcctctgggaattctgtggtgactcattcattggcttttctcttccttcccag  c.167-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center