tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - 737 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.17017
gtacagaatgtgtggacctcttgtccagaggtggagcgtggggcaatgaggtgggagttg  c.280+60

         .         .         .         .         .         .  g.17077
tagccgatatgagtcagggaaccaagttccagcccaacctggtcttcatcaccctgttct  c.280+120

         .         .         .         .         .         .  g.17137
atgattatatatttgactgattaaaaaaatagaaagaaatcttttctataatgcatgcca  c.280+180

         .         .         .         .         .         .  g.17197
cctggctgggaaatcgtctaaactgtcagctgcaagagggtggggggatcattagagcat  c.280+240

         .         .         .         .         .         .  g.17257
agagaaggcctggcccagtggacagggctaggtttcagtagtggcacgggtctgctccag  c.280+300

         .         .         .         .         .         .  g.17317
ggccaggctctctcccccaggctctgtgctcctggcaggtgctcggcctcactcagcctt  c.280+360

           g.17326
caggttctc  c.280+369

--------------------- middle of intron ---------------------
                                         g.17327              g.17334
                                         c.281-368  aggcccct  c.281-361

.         .         .         .         .         .           g.17394
tcctcctccccagcaggcccaggctttggggaagtcccccaaggcctccgtctccttgca  c.281-301

.         .         .         .         .         .           g.17454
gagtctctcaggtgatgcccttgcacctcccttgctactgaccatgccatctaaacaatg  c.281-241

.         .         .         .         .         .           g.17514
cttttcccctaatctgatgtaataaataatgaattatgctcctttttatgactcctctga  c.281-181

.         .         .         .         .         .           g.17574
gtgctggtgacagctgaagggtgggtgtcctgtatgagccctgagtgtgctggtgcagaa  c.281-121

.         .         .         .         .         .           g.17634
actggcccttagaactccttggtgaacttggttgagctgagtgggagggggtgggtggta  c.281-61

.         .         .         .         .         .           g.17694
aggaagatcgagggatacatcagggaaacacattcccaaaaccttatgctctgttgtcag  c.281-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center