tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - 1024 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.17863
gtgagacagcagtcaggggctcctgacagctttcaggaacccgagaagacctgagtcacc  c.389+60

         .         .         .         .         .         .  g.17923
tggtacccctatttctccgctgaccctatggagcctccagacccatggggtgtccctgag  c.389+120

         .         .         .         .         .         .  g.17983
cctgtggggtctcttgggtctgcagtggccgctcctggtccatctgcctgtccccacccc  c.389+180

         .         .         .         .         .         .  g.18043
taccccctgcagcagccccttcccagaccctccccagcacgagtccccttggccagacca  c.389+240

         .         .         .         .         .         .  g.18103
acttgttcactgggcacaagaagcaactttctggatcccttgatccttttcagcaaacct  c.389+300

         .         .         .         .         .         .  g.18163
aggaaatgcgatttccttttgaaatgagaagaaaacacttgaatccagtctgggttgtat  c.389+360

         .         .         .         .         .         .  g.18223
ttgttgctataccaagctgttttaaaaaatgttctttttaatattttttatgcaggcagg  c.389+420

         .         .         .         .         .         .  g.18283
acccataaagacaaaagtggtcacggccgacaaaagtcataagaaggctgtgggtggagc  c.389+480

         .         .         .    g.18315
tccttcaagttcccatgaaggcctgagccaat  c.389+512

--------------------- middle of intron ---------------------
                 g.18316      .         .         .           g.18347
                 c.390-512  ccagccggcctcacccctggccccaatccctc  c.390-481

.         .         .         .         .         .           g.18407
aataagtcctgtcttttccctatttgggctttaagggccaagagtaatttgttcttctct  c.390-421

.         .         .         .         .         .           g.18467
ggccccctaatgtttgccgtgatagggaggaaccagcagacagttgggggtgagagatca  c.390-361

.         .         .         .         .         .           g.18527
cttgtactgtgggttgactggaggaaggggctcagcttgtggccacaagggctcgtgacc  c.390-301

.         .         .         .         .         .           g.18587
ttcccctggagtgtggctcctcctaacgcaggcctcctctgcagcccagggaagctcagt  c.390-241

.         .         .         .         .         .           g.18647
gtgtgcccggcacagaaggctcctgtggccccagagcagggaggctgaggggctgaaatg  c.390-181

.         .         .         .         .         .           g.18707
cgcatgctcagacccttccccagcctcaacgagggaacttgggggaccccctccagacag  c.390-121

.         .         .         .         .         .           g.18767
gagcctgtccttcccctgacaccttctcagggacattggagagggagggtggctcccctt  c.390-61

.         .         .         .         .         .           g.18827
ttatcccacctggctagctttccctcaggagtcctcacctccctctctgtgtgtacccag  c.390-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center