tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C) - upstream reference sequence


                        g.1             .         .             g.28
                        c.-5308 ttatttcacggtccacaaccaggtctct    c.-5281

.         .         .         .         .         .             g.88
ggactctcttacagcaaaacgatatgcaactcaaaagatactggtaggttactagtcctc    c.-5221

.         .         .         .         .         .             g.148
ctcagtcattgataattagtccagtccatcatcatgttatatgaaaatgtctcctaggat    c.-5161

.         .         .         .         .         .             g.208
gaggccactcaggtttgcaggcctccgttccctctgtcaggtcctaaaagcaggacaggt    c.-5101

.         .         .         .         .         .             g.268
ctcagcaaacatggagcttccccctcccagatatctggaataattgagctaagagacaat    c.-5041

.         .         .         .         .         .             g.328
gtcatctccttctcagtattactgtaatataagatttccctcattacataaaccatgtat    c.-4981

.         .         .         .         .         .             g.388
tcattcctttactctcagcaactcctcctcctcgttttcatttctactcaaacttttcta    c.-4921

.         .         .         .         .         .             g.448
ctttggaaataactgtgatgggctggcagcaatactagtgtaacaagtgtgtcccttcag    c.-4861

.         .         .         .         .         .             g.508
tgcacatccattcatacagggcagggttacacaggtgtagaactagtgggctattttacc    c.-4801

.         .         .         .         .         .             g.568
aataggcaacaaattagtccattgtgtgttgctataaaggaatatctgaggctgggtcat    c.-4741

.         .         .         .         .         .             g.628
ttataaagaaaagaagtttatttggcttacggtcctgcaggctgcatgagcatggcatct    c.-4681

.         .         .         .         .         .             g.688
gcatctgctcagcttctggtgagggcctcagggagcttccaatcatggaagaaggcaaag    c.-4621

.         .         .         .         .         .             g.748
gaggagccagcacatcacatggtgagagggagcaagagatagaggtgagaggtcccagac    c.-4561

.         .         .         .         .         .             g.808
tcctttaaacaaccagctctctagtgaactaacagagtgagaactcactcattactgtgg    c.-4501

.         .         .         .         .         .             g.868
aaagggcagtgagccattcatgagggttcttcccccatgacgctaacaccttcaccaggc    c.-4441

.         .         .         .         .         .             g.928
ccataccaacctcagggatcacatttcaatatgacatttggaggggacacacatgcaaac    c.-4381

.         .         .         .         .         .             g.988
tgtatcaggctatgtagctgcatttactgttagccccagttttgcaagactggggtccca    c.-4321

.         .         .         .         .         .             g.1048
tcaggtccataagaaaattgacagaaaagtctaaacacgtagtctgttcctggcttaggg    c.-4261

.         .         .         .         .         .             g.1108
gtcgtcgctgcttccagcgtttatagttgtagccctggccctgtggccaaggtaccaggt    c.-4201

.         .         .         .         .         .             g.1168
ggtgggtggggagaaggggagaggtgaggtaatacagggaagacagacaaaaatgacggt    c.-4141

.         .         .         .         .         .             g.1228
cactggccgggcgctgtggctcatgcctataatctcagcacttatgggatgccaaggcag    c.-4081

.         .         .         .         .         .             g.1288
gtagattacccgaggtcaggagtttgagacctgcctgaccaacacagtgaaaccccgtct    c.-4021

.         .         .         .         .         .             g.1348
ctgctaaaaatataaaaattagctgggcgtggtggcgggaggctaaggcaggggaatcac    c.-3961

.         .         .         .         .         .             g.1408
ttgaacccaggaggtggagtttgtagtgagccaagatcatgccattgcactccagcctgg    c.-3901

.         .         .         .         .         .             g.1468
gcaacagagcgagactgtgtctcaaaaaaaaaaaaaaaaccactaccaccaccaccacca    c.-3841

.         .         .         .         .         .             g.1528
ccaccaacaaaatgacagtcatcacactagcatcctccctacctcctcatccccagatcc    c.-3781

.         .         .         .         .         .             g.1588
actggaaaaatggaggaaagtctggtggggacactcctttagcccactcgtgtggagtag    c.-3721

.         .         .         .         .         .             g.1648
gggcacacaccagtgaaggtgtggaagccagcccttcatgcctgtgtctccccccatttt    c.-3661

.         .         .         .         .         .             g.1708
agacaatcaatgtttcagttgactgttctgcttccctgtcaaattattactctaaggagg    c.-3601

.         .         .         .         .         .             g.1768
gtatctctctgcccattgctaaacattatgcactgaacggcatgtttcttggtccaagga    c.-3541

.         .         .         .         .         .             g.1828
agtgcgacttagtggtccaaactagaataataccttatttcagttcttttatattaatag    c.-3481

.         .         .         .         .         .             g.1888
cactctgggcatttgcagcctccaccaggtaagcaaaagacaatccacagtcagtttctg    c.-3421

.         .         .         .         .         .             g.1948
ttcctgtcaagactcacctgtaccccccagggcactgccctcagtctcactttccaagta    c.-3361

.         .         .         .         .         .             g.2008
tgttgagggcctccccatcagggaatctgcctcatagctataggcagtctgtgtctctcc    c.-3301

.         .         .         .         .         .             g.2068
cgctgctagacagaacagctcttattggcattatgtgcctgagagagagcaagaggaatg    c.-3241

.         .         .         .         .         .             g.2128
tgtttcgattcagcccatctctgcatcactgtggttcccccataaccactccttttattt    c.-3181

.         .         .         .         .         .             g.2188
aatggcctctggtgaccacctcaagggagtacatggtgggtggtatctcttgctgatgtc    c.-3121

.         .         .         .         .         .             g.2248
aatcactttccaaacctgaggcaggttctactgagcagtatggatgtgtcctactttaat    c.-3061

.         .         .         .         .         .             g.2308
gcgctcctcaagtccccctagagattgccatggggtcaggcctcatatggacatcccttc    c.-3001

.         .         .         .         .         .             g.2368
aataggccagttttccattattcttggaaacaatggggaatgtagagacgaatatccaaa    c.-2941

.         .         .         .         .         .             g.2428
tttaatacactttatttgaaaagcaagaattgcaatgcttggcatatacaaagaccaact    c.-2881

.         .         .         .         .         .             g.2488
tgtctttgatatgtccaaagaccaaaaagagaagtttagaggcttttttaaaaggagaaa    c.-2821

.         .         .         .         .         .             g.2548
ttctggccaggtgcagtggctcatgcctgtaatcctggcactttgggaggccaaggcggg    c.-2761

.         .         .         .         .         .             g.2608
cggatcacgaggtcacgagatcgtgaccatcctggctaacacgatgaaaccccatctgta    c.-2701

.         .         .         .         .         .             g.2668
ctaaaaacacaaaaaaattagctgggcgtggtggcaggcacctgtagtcccagctacttg    c.-2641

.         .         .         .         .         .             g.2728
gggggctgaggcaggagaatggcgtgaacccaggaggcagagcttgcagtgagccgatat    c.-2581

.         .         .         .         .         .             g.2788
cgcaccactgcactccagtctgggtgacacagcgagactccatctcaaaaaaaaaaaaaa    c.-2521

.         .         .         .         .         .             g.2848
aaaaaaggagaaatactaattatttttttttctaggaagctcattggcactgtcaaattt    c.-2461

.         .         .         .         .         .             g.2908
gaagaagaggcgtgctctgactggtgagtgactgcagtgggtcaggctggtcttagagca    c.-2401

.         .         .         .         .         .             g.2968
gtagcaggttatgtccatagatattagataggactattaatagtttcaggttacagctgc    c.-2341

.         .         .         .         .         .             g.3028
caggcttacagagaattgcagtttgggggtaatacagtgatttttcttccccatggcctc    c.-2281

.         .         .         .         .         .             g.3088
ttgactctgttttagttgggtgtgacaagaatgacccaatttgtgcaatcaactttcaca    c.-2221

.         .         .         .         .         .             g.3148
ttctgcttcccaactctatgaccaagacgttgaggactgttcatgagccagaaaacaact    c.-2161

.         .         .         .         .         .             g.3208
caagtacaggggcttttgctgctgtcaaatcttccatcacgctaggaaaacagcatgcaa    c.-2101

.         .         .         .         .         .             g.3268
tccaacccacctagccaatttgcctttgccttcttccatcagaggggtggccttccaaat    c.-2041

.         .         .         .         .         .             g.3328
aggatgttgaccattcacctaggaatgactgtctacaaactaagtagctcttggttggtc    c.-1981

.         .         .         .         .         .             g.3388
agtaaagagctgcgtatagggcagtgtccaagtgaccacagaatccagcagctcctcact    c.-1921

.         .         .         .         .         .             g.3448
cagttccagactcagtctgtggggaacagaggctccctgctcatgagtgtctcctctttg    c.-1861

.         .         .         .         .         .             g.3508
ccttcctcaggcaccaggatcccgtatcaaccatttccattttgtaatagaactcttcgg    c.-1801

.         .         .         .         .         .             g.3568
ggactgccctccccgttagagcttttccaagatctctgaagacatcatgagtttttcagg    c.-1741

.         .         .         .         .         .             g.3628
tttcaagattattttatgtccttcagtcacagggggagcttcagctagtgttccatcgta    c.-1681

.         .         .         .         .         .             g.3688
agctagtaagtgcctctcaaatggaaactttatagtctaaaggcccagttccctggaggt    c.-1621

.         .         .         .         .         .             g.3748
gctcacagccttttgccattagccctaggcagtgctccacacagggcacagagaatgtgt    c.-1561

.         .         .         .         .         .             g.3808
gttacctgcagtctggtttctagtctacactgtgtagtccaccctccagggccaaggggc    c.-1501

.         .         .         .         .         .             g.3868
ctggagtgctctaaagactttcctgcaggccctcgtggctctgtgttaatgctgtcagtc    c.-1441

.         .         .         .         .         .             g.3928
ttcctgaagtcctgtcctctcacctcctgcctagatctgcccccagcacacattcctgac    c.-1381

.         .         .         .         .         .             g.3988
tccacacatttctcagtgcctgcgacctggcacacatttctgatccgaactcagtgcctg    c.-1321

.         .         .         .         .         .             g.4048
gggcctggcaggtgcccagggcactccattgctcaaatccaagcctgtggagaggatgac    c.-1261

.         .         .         .         .         .             g.4108
atatcattcccaggtttctgatgagcagaaaaaaaaatctttgtttctatagtgctatcc    c.-1201

.         .         .         .         .         .             g.4168
tcttttatccaccatgtgagaggtcaggagccgactcaccccaagggtctaggagttgtg    c.-1141

.         .         .         .         .         .             g.4228
ccattgaccttactgcctagggtcacaggctggcacccttcagtaccacacattggatct    c.-1081

.         .         .         .         .         .             g.4288
ctccacacagcagcagtgtgcttaactcaatggggaggtgagtagcccaaggtcagatag    c.-1021

.         .         .         .         .         .             g.4348
ttggacctggatagacacttgactgggggacaggctttggaagccactcccctgggcctc    c.-961

.         .         .         .         .         .             g.4408
ctctgtccatggggcctcaatactagagcccacaaggtcggccagagagtgtctgtgcct    c.-901

.         .         .         .         .         .             g.4468
cgaccatgcaaagggtgccaggttgtggctagggatgcccccggggttcctctccctcct    c.-841

.         .         .         .         .         .             g.4528
acctactcctcagcctctgcatgtgcccgtcatggcccctgtgtccttcattctgtccac    c.-781

.         .         .         .         .         .             g.4588
tcatgtgttcactgggcccctccttggtgccaggcacccgctactgagggataccaagcc    c.-721

.         .         .         .         .         .             g.4648
cctgccagagaagcttggagctgggtcacagcagcaaggaggctggagacatcagtggca    c.-661

.         .         .         .         .         .             g.4708
tcagtgcactggtcagtgaggccgctgtgggaggagggagtgggagcagaagctaagagt    c.-601

.         .         .         .         .         .             g.4768
ggactgaagtccttaggccaggaggtagttcagggtttaagaagaggagagacaggcgtc    c.-541

.         .         .         .         .         .             g.4828
ccggggagggagcaggctcaggatgggcctccagtgcctcctctggagctcactacccag    c.-481

.         .         .         .         .         .             g.4888
actacagcagcgcagtgggcagcgcctcagctccttccccttctgctgcctacagcctgg    c.-421

.         .         .         .         .         .             g.4948
acaggacccggaatcaaaccgcaggccctgggtcaccgctgccggaaagagccagttcct    c.-361

.         .         .         .         .         .             g.5008
gtccgtccatgcacccaccaccaaaacccaggccttcctggaggtgctaggg \ gaggccat c.-301


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center