tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - downstream reference sequence


            .         .         .         .         .         . g.33498
aa / ggtgtggtgttcgtttatttccatcctcctctcctgctgtgacacagctctgagtgac c.*2340

         .         .         .         .         .         .    g.33558
aggaggccagggcttcgttcctgctgggcctccttacttgtcccttctctgccttcaggc    c.*2400

         .         .         .         .         .         .    g.33618
ttggcccgcctggcggtgggggtgtggggggagtttcctgcctatgactccctggatttt    c.*2460

         .         .         .         .         .         .    g.33678
aaaggaccaggttcttggctactggaattcgcgcctcctccctgtttctctcctgtctgc    c.*2520

         .         .         .         .         .         .    g.33738
tcctccctctggggagagggacagcagcccttccctgtatccccatcagtggacccaggt    c.*2580

         .         .         .         .         .         .    g.33798
tgctcagccctgcaggcacctgtgagagccatttcccactccccttgcgctggaggacct    c.*2640

         .         .         .         .         .         .    g.33858
gctctccctctggcccacagctcccaggaggcccaggcgtgctcccatgctgtctgcctt    c.*2700

         .         .         .         .         .         .    g.33918
ccctagaggggaggtggggctgcggctgctccatgctacctcctgcttcccgcctgcact    c.*2760

         .         .         .         .         .         .    g.33978
gcccatggcctcacttggaaccctgggctgggtgagctgcatggaggctgagcatggagg    c.*2820

         .         .         .         .         .         .    g.34038
ggcctgggcttgggcaacatggcttcccccagagttagagctgcttgtgttgccaccgcc    c.*2880

         .         .         .         .         .         .    g.34098
tactgtctatgaggatttaacccctgatctccaagtcttggcgccacacagccatggcag    c.*2940

         .         .         .         .         .         .    g.34158
gggttgtctttgtttcaagtttgctctatcccagacctaaccagcgttttcctggagccc    c.*3000

         .         .         .         .         .         .    g.34218
accccatggccaggccctctcagctagaacatctttctcaggcaaggtgactcctgagct    c.*3060

         .         .         .         .         .         .    g.34278
ctgagcccagagccccactgcctcctggctctgcccttcctccgtgggactgcatctttt    c.*3120

         .         .         .         .         .         .    g.34338
acatctaagaaggatgtgggcagtgaaatttgggtcagggttagaaaacagaaaggggca    c.*3180

         .         .         .         .         .         .    g.34398
attgtggcccagcctttgccccttgggggctgggagctaccatttccatcctccacattc    c.*3240

         .         .         .         .         .         .    g.34458
ctccagcccggctctcctcctctctggaccaaccctgcctttcctccttctccattctcc    c.*3300

         .         .         .         .         .         .    g.34518
ctcttcttcttccctttatcccacccagcagtaaataagtgtcacaggggagagaccagt    c.*3360

         .         .         .         .         .         .    g.34578
atctggcccagtggcgcagaggtaacagattttaccaagacagttgtaggtaaagaaaag    c.*3420

         .         .         .         .         .         .    g.34638
cagatttatggctgggcacggtggctcacgcctgtaatccaagcactttgggagggtgag    c.*3480

         .         .         .         .         .         .    g.34698
tcgggtggattactcaaggtcaggagttgaagaccaacctggccaacatggtgaaaccct    c.*3540

         .         .         .         .         .         .    g.34758
gtctctaacagaagatacaaaaattagccaggagtggtggcatgtgcctgtaatcccagc    c.*3600

         .         .         .         .         .         .    g.34818
tactcgggaggctgagacaggagaactgcttgaacccagaaggggaggttgcagtgatct    c.*3660

         .         .         .         .         .         .    g.34878
gagatcacaccattgcactcccacctgggcagcaagagcaaaactccatcttaaaaaaaa    c.*3720

         .         .         .         .         .         .    g.34938
aaaaaaagcagatttattagagaaagtaggaaaatgtgtagcaaggaggcaatgggcaag    c.*3780

         .         .         .         .         .         .    g.34998
ccagcagaagaggagctgactgcaaagtaacaaaggcttactggagattttataggctag    c.*3840

         .         .         .         .         .         .    g.35058
tgtttatgccaactgttgaagagggctttgtgcagtactggtaagccaaggttgcagtga    c.*3900

         .         .         .         .         .         .    g.35118
gccgacttgcaggtgtctgatgatagctgagtgcgggaagattgtgagttatttgcacag    c.*3960

         .         .         .         .         .         .    g.35178
gagggctttgtgtcctggaccacgaagaaaggcagatttatgtaaaccgtgaaaatctga    c.*4020

         .         .         .         .         .         .    g.35238
gacagatctcagttaatttagaaagtttattttggcaaggttgagaatgcatgcccttga    c.*4080

         .         .         .         .         .         .    g.35298
catagccccaggaggttttgatgacatgtgtccaaggtggtcagagcacagtttggtgtt    c.*4140

         .         .         .         .         .         .    g.35358
ttgtttgttttgttttgttttgtttttgagacagagtcttgctctgtcaccaggctggag    c.*4200

         .         .         .         .         .         .    g.35418
tgcagtggtgtgatcttggcttactgcaacctccacctcccaggttcaagcttctgcctc    c.*4260

         .         .                                            g.35440
agcctcctgagtagctgggatt                                          c.*4282


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center