tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - 6322 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14214
gtgcactcttatttttaaaaatcagtttatttttagttgacagataaacattgtatatat  c.256+60

         .         .         .         .         .         .  g.14274
tcatggtgtacaccatgatgtttggaaatatgcacgcattgtgaaatggctaaatcaagc  c.256+120

         .         .         .         .         .         .  g.14334
taattcacatacttatcgtgtatttgttgtaagaacacttaaaagtctactcagcaattt  c.256+180

         .         .         .         .         .         .  g.14394
tcagctgtatggatacagagccctgggataagccctctttgccctcctcacctgtgggtt  c.256+240

         .         .         .         .         .         .  g.14454
ctgtagccatcctcatctgtgggtgttgcatccgtggttgcaaccaacacagatcaaaaa  c.256+300

         .         .         .         .         .         .  g.14514
tatgtggaaaaaataatgaaaatgataacatgtcaataaaagtagataaaaagcaatgca  c.256+360

         .         .         .         .         .         .  g.14574
gtaaagcacttatttacatagcatgtctattgcattaggtattacaagtaacctagaaat  c.256+420

         .         .         .         .         .         .  g.14634
gatttaaagcatatgtacctggggtgtatgcaatactatcccaatttgtatcagggactt  c.256+480

         .         .         .         .         .         .  g.14694
gtgtaagtgcagagtttgttccatggaatatattccctgtgaatagaaggcaggactgta  c.256+540

         .         .         .         .         .         .  g.14754
caacacattgttttaataactgtagtcaccatgtcacacaatacatctcttgaatttatt  c.256+600

         .         .         .         .         .         .  g.14814
tccccctgtctaactgaaattttgtatcctttgaccagcatctctccaacccaccgtgca  c.256+660

         .         .         .         .         .         .  g.14874
aatacagcgctggtaatcaccattctactctctacctctatgagatcaagttttaagatt  c.256+720

         .         .         .         .         .         .  g.14934
ccacatatgtgagatcatgaggtgtttgtctctctgtgcctggcttatttcacttagcat  c.256+780

         .         .         .         .         .         .  g.14994
gatatctccaggttcatccatgctgtcacaaatgacagaatttccttctttgttgaggct  c.256+840

         .         .         .         .         .         .  g.15054
gaatagtattccattgtgtctatgtactacattttctttaccttttcatcatcgatggac  c.256+900

         .         .         .         .         .         .  g.15114
acttaggttgattaatgtcttgaccattgtaaataatgctccaatgcacatgggagggaa  c.256+960

         .         .         .         .         .         .  g.15174
gatacctctttaacatactgatgtcatttcctttggatgtatacacaatactgggattgc  c.256+1020

         .         .         .         .         .         .  g.15234
tggatcatatagttattctatgttttgttttttgaggaacctccatactgttttccataa  c.256+1080

         .         .         .         .         .         .  g.15294
tggatgtactaatctccattcccaccaacagtgtaccagtgttcctttttctccccatca  c.256+1140

         .         .         .         .         .         .  g.15354
tcatcaacacttgttatcttttgtctttttggtaatagccatttttacaggtgtgaagtg  c.256+1200

         .         .         .         .         .         .  g.15414
gtatttcattgtggttttgatttgcatttccctgattagtgatgttgagcatttttttca  c.256+1260

         .         .         .         .         .         .  g.15474
tatacctgtcggccacttctatgtcttctttttagaagtgtctcttcaggtcccttgccc  c.256+1320

         .         .         .         .         .         .  g.15534
atgcgtccgttttaattggattatttgattgcatactattgagatgtttgagttcctgtg  c.256+1380

         .         .         .         .         .         .  g.15594
tattttggatgttaaccaaaatcttggatcttttggatattgatctctcatcctgtatgt  c.256+1440

         .         .         .         .         .         .  g.15654
tgtctcgtcactctgttcattgtttcctttgttgtgcaaaacctttctagtctgatataa  c.256+1500

         .         .         .         .         .         .  g.15714
tctcatctgtctatttttgcttttgttgcctgtgcttttggggtcatagccaagaaatca  c.256+1560

         .         .         .         .         .         .  g.15774
atgcccacaccaacgtcatgaagattttcccctatgttttcttgtagtagttttacaatt  c.256+1620

         .         .         .         .         .         .  g.15834
tcagggcttatgtttaatctttagtccatgttgagttgatttttacatatgatgtgagat  c.256+1680

         .         .         .         .         .         .  g.15894
aagggtcttatttcattcttctgcaggtcaatatctactttcctctacatcatttattga  c.256+1740

         .         .         .         .         .         .  g.15954
agaggctgtcctttccccattttgtgttcttggtatctgtcacaatcagttgactgtaaa  c.256+1800

         .         .         .         .         .         .  g.16014
tgcattgatttatatctgggttcactatttcattccatcagtttatcttcgtttatgcca  c.256+1860

         .         .         .         .         .         .  g.16074
ttactattcagttttgattactatacctttgtaatatatttaagaatcaggtagtatgat  c.256+1920

         .         .         .         .         .         .  g.16134
gcctccatcattgttctttttgtttgttttgcttaagatcactttggctatttgaggtct  c.256+1980

         .         .         .         .         .         .  g.16194
tttgtggttccatacacattttagatttattttgtctattttggtaaaaaatgtcattgg  c.256+2040

         .         .         .         .         .         .  g.16254
aattttaataggcattgcattgaatctgtagatcactttgggtcatatgaacaattaagc  c.256+2100

         .         .         .         .         .         .  g.16314
aatattgagttttctaatccatgaacatgtactgtctttccatttatttttgttactttc  c.256+2160

         .         .         .         .         .         .  g.16374
cgtttctttcatcaatattttacagttttcacatcttccacctctgtcacaaatttattt  c.256+2220

         .         .         .         .         .         .  g.16434
aaaagagttgctgccttgacatccatttttaggcccaatgtaagttgtttaaaacccaat  c.256+2280

         .         .         .         .         .         .  g.16494
cataccacagcatcttttgcccaattaataattcctttccctgttcaattgtttttgatc  c.256+2340

         .         .         .         .         .         .  g.16554
tagcacatttgttcatcatctccctgaccccaaacccaacacatcccacaggagctgact  c.256+2400

         .         .         .         .         .         .  g.16614
acaataaaacctaatggttcacagcagagcagtgtgaaccttctttgcaggtgttgtctt  c.256+2460

         .         .         .         .         .         .  g.16674
ccacaatccctgtgggaaagcctggggtataatgcccatggatctttataaaggtgtagt  c.256+2520

         .         .         .         .         .         .  g.16734
cccacgggtcctctctctctgtctcttgctccccacacaccggttagtgtcctcggactg  c.256+2580

         .         .         .         .         .         .  g.16794
gatagctccccacttcccgtaagtgctgcaaagtgtgctatcctcttctctctggagtct  c.256+2640

         .         .         .         .         .         .  g.16854
gtaagtaatacaccacttctgtgtttcctgtgttttgttgtgttgcttcctctgtgtttt  c.256+2700

         .         .         .         .         .         .  g.16914
ccctaattgacacatctgaacctaacatccttctccatcttggctctcttaaagagtggc  c.256+2760

         .         .         .         .         .         .  g.16974
tgtctcctaaagagtagagataacttaaaactggacataggtcagacaagagccaccagg  c.256+2820

         .         .         .         .         .         .  g.17034
tctactgctagtaaaagtaattgtcttgtggaagggacatgtacaagatgaacacccaat  c.256+2880

         .         .         .         .         .         .  g.17094
taggcattagacagtccaccgggacaaataagtttcctgtgaacatccatgatgaaatct  c.256+2940

         .         .         .         .         .         .  g.17154
cctggatcccccccagggcaaggctagaatttatagccactctacagagagaaacctcaa  c.256+3000

         .         .         .         .         .         .  g.17214
gaccaaattagaaaaaaatacagccaccaccttggttaaatttattcctaagcatttttt  c.256+3060

         .         .         .         .         .         .  g.17274
ttgtagctattataaatgggatttttcagatagtttcttgtcagtgtataaaaacactac  c.256+3120

         .         .         .         .   g.17315
tgaatttgtaagttaggttcatgtctaactttattttacac  c.256+3161

--------------------- middle of intron ---------------------
       g.17316      .         .         .         .           g.17356
       c.257-3161  tgataacaatttatctttgatctcataaaaaacttgacacc  c.257-3121

.         .         .         .         .         .           g.17416
ttttcttctcctgccttattttatgttttgtcattatttacgtctttttatgttgtgtat  c.257-3061

.         .         .         .         .         .           g.17476
tccttaacaaattgtattaagtatcatttaaaaaaatacattgggcttttaacttttata  c.257-3001

.         .         .         .         .         .           g.17536
gtaatgatgtaagtaatttgtacactattatgattgtattagaatattctgaacttgacc  c.257-2941

.         .         .         .         .         .           g.17596
atgtatttaaccacctagttttatattttcgcatggttttgtgtatccagttagtgttct  c.257-2881

.         .         .         .         .         .           g.17656
gttctttcagattgaataactctctttaacatttcttgtaaggcaatacatgctaaagat  c.257-2821

.         .         .         .         .         .           g.17716
gaactccccccgtttttttttttctttgtctgataaagtctttactgctctgcatttcta  c.257-2761

.         .         .         .         .         .           g.17776
aaggacaggcttgccaggtgtagtattcttggttggcaaggaatttttcctttctgtact  c.257-2701

.         .         .         .         .         .           g.17836
ttgtatgattccactctctcctggcctgtaggttttctgctgagaagcctttggtagttt  c.257-2641

.         .         .         .         .         .           g.17896
tataggggttcctttgtacattgcttgtctcttgctggtttcaaaattctctttgccttt  c.257-2581

.         .         .         .         .         .           g.17956
gatgtttgggaatttgtttaagatgtgtcttggtgaagatctcttcatatttatctgtta  c.257-2521

.         .         .         .         .         .           g.18016
ggggttttttgggcttcatgaatgtggatgtccattcccatcctgttttgggacattttc  c.257-2461

.         .         .         .         .         .           g.18076
tttaattatttctttaattacactttctgttcctttcactttctctgatgctccttggac  c.257-2401

.         .         .         .         .         .           g.18136
caccataatgcatatattgttttgcttcacagtaaccgttggtactgttggctttcttcc  c.257-2341

.         .         .         .         .         .           g.18196
ctctttttcattctttattttttttttcttcctgtgacttggtaatttcaaatgatctgt  c.257-2281

.         .         .         .         .         .           g.18256
tttcaagctcactgattctttcttccgattaatcaactctgctgttgacattctctgtgg  c.257-2221

.         .         .         .         .         .           g.18316
aattttcttagttcagatattgtgttgttgttaattttagaatttctgctttcttcttta  c.257-2161

.         .         .         .         .         .           g.18376
ttatgttgtctgtgtatattaaactactcattttgttcatgtattgttttcctgacatga  c.257-2101

.         .         .         .         .         .           g.18436
cttagttgtctatccatattctctagtagctgactgagcttctgtaagatgactgttttc  c.257-2041

.         .         .         .         .         .           g.18496
aagtctttgtcaggctgttgtaaatgtctattcctttcgggttggttacttgtgcttcat  c.257-1981

.         .         .         .         .         .           g.18556
tttgtttctttggtgccgtcactgttccctgattgctcaggagcctgtggcaatatgttg  c.257-1921

.         .         .         .         .         .           g.18616
gaatgtgcactttgaagaagcagggacttaatccagtatttacagactggctttgtcagg  c.257-1861

.         .         .         .         .         .           g.18676
gaacgcccttcaccagtcagcctgttcacagattctgggcaggccatgtggtgtggttca  c.257-1801

.         .         .         .         .         .           g.18736
agggtggtcagagccagtatccagagaggtgacctgaggcctggctccatgagggctgaa  c.257-1741

.         .         .         .         .         .           g.18796
ctggcactggaataggccttgtacttgggtctgcagatgtcagccaggtgctgtgatggg  c.257-1681

.         .         .         .         .         .           g.18856
tctcatccttgggtccacagggaagggcctggagcctgagttcatggggactgacctggc  c.257-1621

.         .         .         .         .         .           g.18916
actaggacagatctggaagctgaatctatggaggtgggtcaggatcctgggtctgtagtg  c.257-1561

.         .         .         .         .         .           g.18976
ctagcccgaaggcacaagctaagactgatatcttagcttatcatgcctttatcatgccct  c.257-1501

.         .         .         .         .         .           g.19036
tatctctatgtgtttccagacttctgtttcctgcactttctggttctttattccataggg  c.257-1441

.         .         .         .         .         .           g.19096
acatgttggatgatttctgtcagtcaggcaccgtgctaatgggataattataagaggccc  c.257-1381

.         .         .         .         .         .           g.19156
tgccctcgtggaaccttttctctgggatagtattaagacacacagatcaaaataacagtc  c.257-1321

.         .         .         .         .         .           g.19216
agaaattcctgataggaaccatgaagaaattaagtgatgagtgagacagagacgaggttg  c.257-1261

.         .         .         .         .         .           g.19276
gtggggcctctcggggatggtgattttggccagtctccaaagctggacagggatagttgt  c.257-1201

.         .         .         .         .         .           g.19336
gcagagagccagaaatggtgctcctgagcagcctccctaggaatgacagtcccagggtgc  c.257-1141

.         .         .         .         .         .           g.19396
aggcgctgggggataccgagcagagacggggccaccatagtgagtggacagcaaacaggt  c.257-1081

.         .         .         .         .         .           g.19456
caggtggaccagcatgggcagatcacatgtagatgaggttggattttattttgttatttt  c.257-1021

.         .         .         .         .         .           g.19516
attttattgttaaaaaaaaaaaaaagtagactgggcgtggcatggtggctcacgcctgta  c.257-961

.         .         .         .         .         .           g.19576
atcccagcactttgggaagccgaggagggtggatcacctgaggtcaggagttggagacca  c.257-901

.         .         .         .         .         .           g.19636
gcctggccaatatgatgatacaccgtgtcaactaagaatacaaaaaattagctgggcgtg  c.257-841

.         .         .         .         .         .           g.19696
gtggtgggtgcctgtaatcccagctactcaggaggctgaggcaggagaatcgcttgaacc  c.257-781

.         .         .         .         .         .           g.19756
tgggaggtggaggttgcagtgagccaaggtcgcgccattgccctccagcctgggtgacaa  c.257-721

.         .         .         .         .         .           g.19816
gagtgaaactctgtctccaaaaaaaattttaaaaaagataaaatatttcttttcttttct  c.257-661

.         .         .         .         .         .           g.19876
tttcttttttttttttttttttgagacagagtcttgctctgtcgcccaggctggagttca  c.257-601

.         .         .         .         .         .           g.19936
gtggcacagtctcagctcactgcaagctctgcctcccgggttcacgccattctcctgcct  c.257-541

.         .         .         .         .         .           g.19996
cagcctcccgagtagctaggattacaggtgcctgccaccacgcccggctaattttttgta  c.257-481

.         .         .         .         .         .           g.20056
tttttagtagagatggggtttcactgtgttagccaggatggtctcgatctcctgacctcg  c.257-421

.         .         .         .         .         .           g.20116
tgattcgtccgccttggcctccctaagtactgggattacaggcgtgagccaccgtgcctg  c.257-361

.         .         .         .         .         .           g.20176
gccaaaaaaagataaaatatttcaaatatttatattgattacatattgaaatgtagtgtt  c.257-301

.         .         .         .         .         .           g.20236
ttggatatttttaggctaaaaaatagttaaaattaatttgacctcattctttgtactatt  c.257-241

.         .         .         .         .         .           g.20296
ttaatgtggctttcatagaatttgaattttgcatgtgatttgtattatatttctgtcagc  c.257-181

.         .         .         .         .         .           g.20356
agtgccagtcaaaggtatgtaatagtgtaatagatgcagaattgatgacaagaccaagcc  c.257-121

.         .         .         .         .         .           g.20416
aagaagagcagatttctctgtctggattccactgagggccaaaagagaaatttgccagcc  c.257-61

.         .         .         .         .         .           g.20476
attgtcagcctctgggaattctgtggtgactcattcattaacttttctctcccttcccag  c.257-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center