tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - 1039 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.22127
gtaagacagcagccaggggctcccaacagctttcaggaacctgaaaagacctgattcacc  c.482+60

         .         .         .         .         .         .  g.22187
tggtacctctatctctccgctgaccccatggatcctccaggcccgaggcctccctgagcc  c.482+120

         .         .         .         .         .         .  g.22247
tgtggggtttcctgagcctgcgttggcccctcctggtccatctgcctgtccccaccccta  c.482+180

         .         .         .         .         .         .  g.22307
ccccctgcagcagccccttcccataccctccccagcaggagtccctttgtccaggctgaa  c.482+240

         .         .         .         .         .         .  g.22367
ttgttcactgggcacaggaggtgactttctaggtcccttgaaccttttcaggcaacctag  c.482+300

         .         .         .         .         .         .  g.22427
gaaatgtaatttccttttgaaatcagaagaaaacacttgaatccagcctggcttgtattt  c.482+360

         .         .         .         .         .         .  g.22487
ttccttactctaagttggtttaaaaaatgtaatttttaatattttttatgtgggcaggga  c.482+420

         .         .         .         .         .         .  g.22547
cccataaagacaaaagtgtccgtagcccacaaaagtcataataaggccatgggtggagct  c.482+480

         .         .         .         .  g.22587
cccttaagttcccatgaggacctgagcccacccagccggc  c.482+520

--------------------- middle of intron ---------------------
          g.22588             .         .         .           g.22626
          c.483-519  ctcacccctggcccccgatttctcactaagtccttcttt  c.483-481

.         .         .         .         .         .           g.22686
atcctatttgggttttaggggcaaagagtaacttgctcttctctggccctccagtgtttg  c.483-421

.         .         .         .         .         .           g.22746
ctgtggttgggaggaaccagcggcagacagggtggggcgaggactcacttgtactgtgtg  c.483-361

.         .         .         .         .         .           g.22806
ttaactggaggaaggggctcagcttgtggccacaggggcttgtgatcttcccctggagtg  c.483-301

.         .         .         .         .         .           g.22866
cggctcctcctaacgcaggcctcccctgcagcccagggaagctcagtgtgtgcccagcac  c.483-241

.         .         .         .         .         .           g.22926
agaaggctcctggatctacagctctgaccccagagcagggaggccgaggggctgaagtgt  c.483-181

.         .         .         .         .         .           g.22986
gcatgctcagacccttccccagcctcaagaagggagcacagggggacccactgctgacac  c.483-121

.         .         .         .         .         .           g.23046
gaggagcctgtcctcctgacgccttctcagggactttgggcagggagggtggctcctctt  c.483-61

.         .         .         .         .         .           g.23106
tcatcccacctggccagctttccatcaagagtccctgtctccctctctgtgtgtacccag  c.483-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center