tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - 578 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.23420
gtaggtgctggctgagggtgggagcgctgggcactgtctgccctgccctctcccactccg  c.736+60

         .         .         .         .         .         .  g.23480
ttcccacagacagtaatccccatccctgcccctggtccaagcgtctccagcctggcttgg  c.736+120

         .         .         .         .         .         .  g.23540
tcttccttcttgtgatcgccccatccccacgtcctgtgtatccccaaggaccctggtctc  c.736+180

         .         .         .         .         .         .  g.23600
atcagtccctctctcagggctgggggacccctcatctcccggagccaactccaggagggc  c.736+240

         .         .         .         .           g.23649
agggccagttcctcctatcttcaggcccagccaggcagggggcagtcag  c.736+289

--------------------- middle of intron ---------------------
g.23650             .         .         .         .           g.23698
c.737-289  ctcctcaactgggtgacaagggtcaggatgagaagtggtcgtgggattt  c.737-241

.         .         .         .         .         .           g.23758
attcagccttggtcagagcagaacacagagattttccacgtgttggtttttactctagtt  c.737-181

.         .         .         .         .         .           g.23818
ccccttctcatcccccttcctcagggtgtcccctaattgcaaggccccattctgtcccca  c.737-121

.         .         .         .         .         .           g.23878
gccccagggctccttgtccagtgtcccagcccccagccagccctgcgccccactgtcctc  c.737-61

.         .         .         .         .         .           g.23938
tgggagggaggtgctgcatgggcccctccccgcctgctcaggagactgcttcttttccag  c.737-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center