tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - 422 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.24030
gtgagttggtttctccagaaactgggggcttcgtgggttcaggaactgcttcccatccac  c.768+60

         .         .         .         .         .         .  g.24090
tgccgagcctgggtgggcacaatcccttgtcctcatggctgccctgactctctgacatgg  c.768+120

         .         .         .         .         .         .  g.24150
cctgggggatctgggctgactgtgggggacacacggccattttgagcagcacacagacca  c.768+180

         .         .         .   g.24181
gcaggccgtgctgcagccctgtccttcctgc  c.768+211

--------------------- middle of intron ---------------------
                  g.24182     .         .         .           g.24212
                  c.769-211  agcctcggtgacaccatcactccacagctgg  c.769-181

.         .         .         .         .         .           g.24272
ccccatggggatggggtgaccacctgacccacctcagcatggggtcctggatgtgctgag  c.769-121

.         .         .         .         .         .           g.24332
cctcagctgcctggggtgacctcattggaaggggttggggatggcaggtccagctgtgta  c.769-61

.         .         .         .         .         .           g.24392
ctggggaccctgaagctgagcccggggtgtggacttgagtgggctctttgtcttcccaag  c.769-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center