tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D) - 184 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.30900
gtaagtgttttgtgccttgagacgcagcaggaggacagggaatagggacggtgtcctaac  c.1027+60

         .         .         .    g.30932
tgctgtccctatagctgagagggctcttctgg  c.1027+92

--------------------- middle of intron ---------------------
                 g.30933      .         .         .           g.30964
                 c.1028-92  aggtttcactgctggaagcagggggccccatg  c.1028-61

.         .         .         .         .         .           g.31024
tcgatcctgtgctgatcgtccttggagcattgagaccctaaatctcttctctcttctcag  c.1028-1


Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center